Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 516,647 (bp)   Positions: 76
Conservation 
Genes ( + ) 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.009
--
.015
--
--
.005
.001
.324
0
.023
.384
.969
.767
.217
.006
.007
.164
.175
.184
.217
.208
.09
--
--
.432
.013
.003
.008
.342
--
.215
.001
--
.075
.076
.078
.009
.067
--
--
--
.499
.008
.09
--
--
0
.018
--
--
--
.193
.025
.028
.409
.036
.033
--
.127
--
--
.004
--
.055
--
--
--
--
--
.054
.082
0
.08
.019
.019
0
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
2
C
A
A
A
C
A
A
G
G
A
T
2
C
A
T
T
T
2
C
T
C
T
C
T
C
A
T
G
T
2
G
T
C
2
T
A
2
C
C
2
2
2
2
2
C
C
C
G
G
T
4
2
T
C
C
T
G
68
C
2
G
T
2
C
2
A
C
2
6
4
G
4
2
4
3
  72,670,537
  72,673,055
  72,683,299
  72,685,764
  72,685,814
  72,694,941
  72,729,230
  72,729,348
  72,745,888
  72,745,902
  72,753,001
  72,758,624
  72,765,090
  72,767,115
  72,771,331
  72,771,332
  72,771,375
  72,771,378
  72,771,381
  72,771,427
  72,771,433
  72,771,464
  72,802,596
  72,807,072
  72,808,740
  72,809,784
  72,811,444
  72,817,588
  72,822,179
  72,838,653
  72,842,835
  72,844,028
  72,844,991
  72,848,224
  72,848,225
  72,848,226
  72,856,593
  72,859,535
  72,871,580
  72,871,594
  72,871,598
  72,876,223
  72,899,310
  72,906,249
  72,916,545
  72,940,920
  72,945,137
  72,950,801
  72,952,438
  72,955,141
  72,955,142
  72,963,584
  72,966,483
  72,966,484
  72,980,362
  72,990,249
  72,990,250
  72,990,270
  72,999,454
  73,011,658
  73,011,682
  73,024,853
  73,032,451
  73,054,126
  73,056,231
  73,057,160
  73,057,161
  73,057,768
  73,074,972
  73,083,022
  73,083,024
  73,109,904
  73,110,988
  73,112,331
  73,141,860
  73,175,206
-/2
8/C
4/A
3
4
-
G
ACACACACACACACACAT/ACACACACACACACACATACACACAT
2
2
2
G
-/2
-/C
G
G
2
4
-
A
C
-
-
4
-/T
-/C
2
-/T
-
-/T
-/2
-/G
-/T
2/C
-/2
-/T
2
-
3/C
3/C
-/2
-/2
-/2
-/2
-/2
G
2/C
2/C
2/G
2/G
-/T
-
-/2
-/T
5/C
12/C
-/T
T
-
9/C
-/2
-
9
-/2
2/C
-/2
-/A
11
-/2
-/6
-/4
3
-/4
-/2
-/4
-/3