Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 26,495 (bp)   Positions: 62
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.014
.133
.002
.188
--
--
0
.003
.054
.465
.673
.955
1
.998
.998
0
.002
0
.046
.002
.012
.001
--
.551
.458
.002
.008
--
.041
.008
.016
.045
.04
.018
.017
.054
.122
--
--
--
--
--
--
.012
.169
.14
.089
.062
.001
.001
.006
.001
.043
.001
.018
.006
0
0
0
.019
.046
.004
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
Cd4
6
G
G
G
G
C
A
T
9
2
4
2
A
15
6
C
4
C
G
G
C
2
3
T
T
G
G
A
T
2
C
T
G
T
C
T
T
A
C
T
2
C
C
C
A
G
G
6
T
A
T
A
T
T
T
A
G
C
A
G
G
T
  224,400,353
  224,400,416
  224,401,550
  224,402,896
  224,404,095
  224,405,517
  224,405,779
  224,406,521
  224,407,088
  224,407,232
  224,408,069
  224,408,071
  224,408,136
  224,408,554
  224,408,755
  224,409,106
  224,409,491
  224,409,495
  224,410,851
  224,410,977
  224,412,629
  224,412,633
  224,413,683
  224,413,921
  224,413,931
  224,413,945
  224,413,984
  224,416,345
  224,417,054
  224,417,110
  224,417,153
  224,417,270
  224,417,297
  224,417,499
  224,418,166
  224,418,197
  224,418,630
  224,419,161
  224,419,162
  224,419,168
  224,419,177
  224,419,208
  224,419,210
  224,419,727
  224,420,135
  224,420,246
  224,420,475
  224,420,970
  224,421,046
  224,421,047
  224,421,048
  224,421,558
  224,421,601
  224,421,725
  224,421,939
  224,422,132
  224,422,234
  224,422,564
  224,423,023
  224,423,973
  224,424,961
  224,425,416
-/6
25
T
A
C/G
T
G
G
-
-/2
-/4
-/2
16
-
-
5
-
8
GTCTCTCTCTC/GTCTCTCTCTCTC
3
3
-
-
C
13
A
A
2
A
-
9
C
A
C
A
C
TACACACACACACACACACACAC/TACACACACACACACACACACACACACACACACACAC
G
T
3
-
3
37
T
G
-
A
-
2
2
3
G
G
C
-
G
A
G
C
-
13/G
-/T