Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 198,993 (bp)   Positions: 237
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
1
.981
.201
.227
.228
.012
.975
0
.028
.029
.003
0
.05
.119
.116
.113
.331
.014
.017
--
--
--
--
--
--
.006
.006
--
.015
--
--
--
--
--
--
.128
.109
0
0
.004
.001
.003
.001
.001
.001
.009
.051
.059
.036
.018
.012
.007
.007
.009
.042
.032
.034
.023
.066
.044
.019
.008
.018
.003
.002
.002
.007
.032
.028
.36
.018
.09
.021
.013
.873
.012
.038
.089
.002
0
.659
.002
.001
--
.197
.035
.045
.014
0
0
.003
.188
.063
.051
.146
.18
.177
.001
.029
.001
0
.006
.491
.001
.474
.161
--
--
--
--
--
.09
.237
.008
.123
.162
.27
.005
.002
.002
0
.009
.004
.296
.138
.48
--
.048
.316
--
.085
.316
.013
.048
.028
.745
.661
.004
.095
.172
.058
.037
.367
.699
.013
.016
.006
.172
0
--
.238
0
.328
0
.001
0
.002
.725
.087
.453
0
.031
.247
.004
.013
.243
.063
.007
.022
.001
.393
.002
.021
.016
.128
.556
.084
.545
.094
.917
.749
.002
.002
.003
.187
.06
.058
.018
.023
.011
.995
.147
.052
.079
.035
--
.443
.084
.003
.003
.048
--
--
.074
.103
.051
--
--
--
.013
.021
--
--
--
--
.003
.024
.001
0
.008
.001
.001
.037
--
--
0
0
0
0
.001
.002
.001
0
0
0
.005
.003
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
T
T
2
12
10
2
G
T
10
8
T
A
G
A
6
4
C
2
C
12
10
G
C
G
16
A
C
A
4
A
G
8
6
T
T
A
5
A
C
A
C
A
C
C
A
C
G
C
G
G
G
T
T
G
G
A
G
G
A
T
T
C
G
C
C
C
C
G
G
2
C
A
2
T
T
G
A
G
T
T
G
G
T
4
G
T
24
C
G
A
C
C
T
G
A
G
G
G
G
A
T
A
G
T
A
C
T
G
G
G
G
T
A
C
C
G
G
T
A
G
A
T
T
G
A
C
T
C
A
T
C
C
T
6
C
G
C
T
C
C
G
G
A
A
C
G
G
C
T
G
A
C
C
A
10
8
A
T
2
G
A
A
T
C
G
4
C
G
T
G
G
T
C
3
C
8
T
T
C
C
C
T
C
G
A
4
2
C
G
A
G
C
8
6
C
A
C
G
A
T
T
A
A
G
G
G
C
G
G
C
A
C
T
3
C
T
T
T
T
C
A
C
T
A
C
A
T
C
G
G
G
T
2
A
C
A
C
  289,603,956
  289,606,248
  289,609,782
  289,609,801
  289,609,803
  289,610,412
  289,611,955
  289,612,624
  289,614,443
  289,614,445
  289,615,025
  289,615,853
  289,616,809
  289,618,368
  289,618,915
  289,618,917
  289,618,981
  289,619,910
  289,619,911
  289,621,279
  289,621,281
  289,621,700
  289,624,305
  289,624,626
  289,624,637
  289,629,186
  289,632,020
  289,634,739
  289,634,983
  289,636,946
  289,636,969
  289,638,456
  289,638,458
  289,638,996
  289,639,160
  289,642,107
  289,642,110
  289,642,821
  289,642,827
  289,642,840
  289,642,845
  289,642,851
  289,642,859
  289,642,861
  289,642,863
  289,642,879
  289,642,892
  289,642,897
  289,642,913
  289,642,915
  289,642,920
  289,642,925
  289,642,927
  289,642,928
  289,642,935
  289,642,940
  289,642,941
  289,642,961
  289,642,976
  289,642,980
  289,642,982
  289,642,985
  289,642,997
  289,643,008
  289,643,010
  289,643,012
  289,643,015
  289,643,017
  289,643,122
  289,643,875
  289,650,868
  289,650,922
  289,654,227
  289,655,428
  289,655,586
  289,655,712
  289,655,948
  289,656,063
  289,656,929
  289,658,107
  289,658,229
  289,658,309
  289,658,820
  289,658,969
  289,659,834
  289,661,885
  289,661,948
  289,662,480
  289,663,034
  289,663,807
  289,663,829
  289,664,016
  289,664,283
  289,664,339
  289,664,360
  289,664,370
  289,664,420
  289,666,426
  289,666,435
  289,666,457
  289,666,723
  289,667,021
  289,667,869
  289,668,279
  289,668,455
  289,668,679
  289,668,877
  289,668,915
  289,668,925
  289,668,993
  289,668,996
  289,669,471
  289,669,785
  289,670,485
  289,670,606
  289,671,076
  289,671,117
  289,671,535
  289,671,609
  289,671,777
  289,671,795
  289,671,943
  289,672,643
  289,676,070
  289,676,297
  289,678,173
  289,678,810
  289,679,964
  289,682,319
  289,682,617
  289,685,197
  289,685,285
  289,685,932
  289,686,991
  289,687,449
  289,687,690
  289,687,712
  289,688,037
  289,688,403
  289,688,760
  289,688,867
  289,689,346
  289,690,314
  289,690,487
  289,691,971
  289,692,348
  289,697,606
  289,698,141
  289,699,304
  289,699,489
  289,700,244
  289,702,258
  289,702,430
  289,706,455
  289,707,887
  289,707,889
  289,709,773
  289,710,901
  289,712,327
  289,719,539
  289,720,919
  289,721,379
  289,723,054
  289,724,576
  289,726,623
  289,727,039
  289,728,779
  289,729,979
  289,730,054
  289,730,625
  289,730,928
  289,731,480
  289,731,727
  289,732,050
  289,733,462
  289,733,515
  289,735,526
  289,735,638
  289,736,128
  289,737,455
  289,738,078
  289,740,156
  289,741,021
  289,741,122
  289,741,661
  289,741,805
  289,741,807
  289,741,851
  289,741,852
  289,742,309
  289,744,351
  289,745,367
  289,748,964
  289,748,966
  289,749,361
  289,751,406
  289,752,254
  289,756,942
  289,757,684
  289,759,446
  289,760,138
  289,761,400
  289,761,401
  289,766,727
  289,767,417
  289,767,421
  289,768,388
  289,769,396
  289,769,773
  289,771,564
  289,773,218
  289,774,945
  289,774,961
  289,775,201
  289,775,226
  289,779,876
  289,780,737
  289,781,127
  289,781,726
  289,781,905
  289,783,947
  289,784,253
  289,784,986
  289,787,412
  289,787,641
  289,788,271
  289,788,331
  289,788,638
  289,788,959
  289,789,400
  289,789,522
  289,789,814
  289,790,314
  289,790,580
  289,790,770
  289,793,661
  289,793,662
-
C
-
-/12
-/10
-
GT/GTT
C
-
-/8
C
-
T
7
-/6
-/4
T
-/2
-
-/12
-/10
9
4
2
-
6
11
-
-
3
23/G
-/8
-/6
5
A
-/A
-/5
G
G
G
G
G
A
T
G
2
T
G
2
T
T
C
G
T
2
G
A
C
2
-
C
A
A
-
A
A
-
T
GACTAAAAGCACATTCTCTCTCCCTTCCCCCACTCAGACAGGCAGACACACAC/GACTAAAAGCACATTCTCTCTCCCTTCCCCCACTCAGACAGGCAGACACACACAC
-/2
T
3
-
C
-
A
2
-
A
G
3
T
A
-/4
GA/GAA
C
-
T
T
C
12
T
-
8
T/A
5
A
A
-
G
2
C
-
5
G
T
5
3/G
19/G
2
11
TTTGTTGTTGTTGTTG/TTTGTTGTTGTTGTTGTTG
G
T
G
A
T
C
G
T
G
C
C
3
G
T
A
T
3
C
T
T
C
-
T
A
2
G
A
T
A
10/G
T
-
T
A
GATGTATGT/GATGTATGTATGT
3
4/T
A
3
T
T
G
-/10
-/8
G
3
-
10
T
2
13
3
2
-
7
A
C
A
A
C
5
-
3/C
-/8
C
C
T
T
T
C
-
T
G
-/4
-
A
T
G
A
A
-/8
-/6
T
-
T
-
4
C
C
3
AAGGAAGGAAGGAAG/AAGGAAGGAAGGAAGGAAG
C
C
C
T
GTT/GTTT
A
T
-
T
13
-
T
C
C
C
C
T
G
T
3
T
2
G
A
T
C
A
A
C
-
13
T
2/A
-/C