Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 38,982 (bp)   Positions: 97
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.001
0
.003
.003
0
.028
.016
.003
.007
.005
.081
.074
--
.021
.11
.07
--
.015
.003
.001
.011
.008
.002
.002
.004
.046
.049
--
.007
.006
.003
.205
.592
.004
.06
.064
.103
.319
.074
.007
.107
.037
.06
.189
.193
.189
.185
.013
.118
--
--
.056
.005
.005
.014
.011
.704
.04
.019
.589
.001
.001
--
--
--
--
.002
.001
.007
.038
.035
.045
--
--
--
--
.079
--
--
--
--
.237
.129
.054
.393
.038
--
.006
.217
.013
0
.009
.003
.001
.023
.214
.353
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
T
T
C
A
C
T
C
A
T
C
2
5
G
A
6
A
3
G
G
G
3
2
A
G
T
A
A
A
T
G
A
G
G
T
26
16
T
C
C
4
6
T
T
G
3
2
A
A
A
G
A
T
G
T
G
A
G
A
T
C
A
6
A
G
T
G
T
G
G
A
G
G
G
C
A
G
G
G
G
A
G
30
2
T
10
A
C
A
3
A
T
G
T
T
C
T
A
  42,274,691
  42,275,478
  42,275,482
  42,276,029
  42,276,412
  42,277,272
  42,277,360
  42,277,429
  42,277,692
  42,277,765
  42,278,067
  42,278,114
  42,278,137
  42,278,307
  42,278,537
  42,278,844
  42,279,729
  42,280,327
  42,280,581
  42,280,804
  42,281,277
  42,281,278
  42,281,464
  42,283,775
  42,284,920
  42,285,952
  42,285,967
  42,286,626
  42,288,230
  42,289,028
  42,289,212
  42,289,759
  42,290,188
  42,290,405
  42,290,820
  42,290,830
  42,290,864
  42,291,202
  42,291,785
  42,294,409
  42,295,319
  42,296,554
  42,296,732
  42,297,188
  42,297,834
  42,297,835
  42,297,836
  42,298,054
  42,298,243
  42,298,648
  42,298,841
  42,299,136
  42,299,151
  42,300,016
  42,300,625
  42,300,750
  42,300,801
  42,300,886
  42,301,037
  42,301,458
  42,301,724
  42,302,333
  42,302,518
  42,302,568
  42,302,675
  42,302,690
  42,302,942
  42,302,943
  42,302,950
  42,302,968
  42,302,979
  42,303,064
  42,303,144
  42,303,167
  42,303,285
  42,303,501
  42,303,880
  42,304,061
  42,304,142
  42,304,353
  42,304,837
  42,305,080
  42,306,901
  42,307,477
  42,307,865
  42,307,996
  42,308,731
  42,308,877
  42,309,100
  42,309,601
  42,310,028
  42,310,141
  42,311,374
  42,312,594
  42,313,066
  42,313,156
  42,313,159
2/T
A
T
G
2
C
T
T
C
-
-
-/5
T
G
-
G
-
A
A
T
-
-/2
G
C
C
C
G
G
A
15
G
11
A
C
-/26
-
C
T
31
-
-
C
C
A
-/3
-/2
-/A
G
G
A
2
C
A
C
A
G
A
T
C
T
G
-
G
A
C
GA/GAAA
C
A
A
G
A
A
C
T
G
A
A
C
A
T
A
-
-
A
-
G
T
AGTGTGTGTGTGTGTGTGTGTGT/AGTGTGTGTGTGTGTGTGTGTGTGTGTGT
-
C
G
A
G
C
T
A
T