Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 138,746 (bp)   Positions: 229
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
.951
.09
.294
.001
.003
.126
0
.001
0
.002
.002
0
.959
.144
.007
.002
0
.001
0
.008
.007
.001
0
0
.001
.002
.002
0
.028
.001
.04
.741
.294
.053
.025
.001
--
.003
.051
.08
.001
0
.098
.095
.019
.016
.07
.171
.929
1
.001
.06
.099
.027
.001
.003
.997
.001
0
.003
.039
.003
.003
.84
.001
0
0
.012
.005
.056
.008
0
0
.002
0
.013
.107
.011
.005
0
.266
1
.004
.008
.007
.007
.001
0
.001
0
.007
0
.011
.002
.02
.006
--
--
.001
--
--
--
.001
.011
0
.491
.004
.007
.002
.001
0
.019
.006
0
.058
.6
.037
.003
.07
.018
--
.01
.001
.004
.043
.001
.005
.014
.035
.011
0
0
0
.116
.024
.015
.022
.017
.003
.008
.003
.007
.258
.007
0
.015
.926
0
.001
.037
.001
.003
0
.028
0
.001
0
.019
.005
.008
0
.87
.252
.296
0
.001
.003
0
.017
.097
.911
.897
.001
.005
0
--
0
.688
.347
.048
.001
.294
0
.011
.004
--
.009
0
0
.195
.01
0
.003
.001
.177
.002
.003
.014
.519
.261
.187
.032
.207
.36
0
.006
.001
.002
.047
.001
.423
.117
.002
.005
0
.002
.002
.977
.096
.008
.011
.001
.02
.002
.001
.004
.224
.654
.04
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
--
G
G
T
C
7
G
4
A
T
G
A
A
C
T
3
A
A
G
A
G
T
G
A
T
A
2
C
C
C
T
A
T
T
A
T
G
A
C
5
T
2
7
A
C
C
A
C
2
T
G
T
4
2
T
A
A
T
A
C
A
C
T
T
8
4
A
A
G
6
4
4
C
A
A
T
C
T
C
C
A
A
C
T
G
G
A
20
C
G
T
C
A
T
C
T
T
C
A
A
T
6
4
T
G
A
T
G
T
G
A
A
C
C
G
A
G
A
A
G
A
G
A
A
A
A
A
A
A
T
G
G
G
G
A
6
C
G
G
A
A
T
C
G
A
G
A
T
G
A
C
A
A
T
C
C
G
T
C
C
T
C
3
8
6
T
A
T
A
T
T
16
14
T
T
C
A
C
A
T
T
G
A
A
7
C
G
G
A
A
A
G
G
A
T
A
8
T
A
C
T
C
G
18
20
A
T
G
T
A
A
T
C
4
T
T
G
G
A
T
C
T
2
2
A
C
C
A
A
A
  99,420,866
  99,421,456
  99,421,697
  99,422,517
  99,422,570
  99,423,242
  99,424,329
  99,424,468
  99,424,483
  99,425,111
  99,425,526
  99,425,893
  99,426,437
  99,429,231
  99,429,577
  99,430,304
  99,430,306
  99,430,975
  99,431,609
  99,432,645
  99,432,693
  99,432,849
  99,432,900
  99,433,148
  99,433,734
  99,434,099
  99,434,754
  99,435,588
  99,436,052
  99,436,160
  99,437,201
  99,437,730
  99,437,864
  99,437,999
  99,438,059
  99,438,286
  99,438,368
  99,439,469
  99,439,734
  99,439,799
  99,440,037
  99,440,040
  99,440,698
  99,441,190
  99,441,318
  99,441,329
  99,441,559
  99,442,985
  99,443,103
  99,443,208
  99,443,391
  99,444,279
  99,444,281
  99,444,333
  99,445,075
  99,446,923
  99,447,339
  99,447,414
  99,450,851
  99,451,270
  99,451,343
  99,451,455
  99,453,285
  99,453,547
  99,453,754
  99,453,923
  99,454,825
  99,455,234
  99,456,567
  99,456,606
  99,457,457
  99,458,195
  99,459,201
  99,459,643
  99,459,709
  99,460,013
  99,460,214
  99,462,333
  99,462,619
  99,467,358
  99,470,717
  99,470,822
  99,476,871
  99,477,653
  99,477,800
  99,478,295
  99,479,046
  99,479,383
  99,479,846
  99,479,875
  99,479,888
  99,480,365
  99,480,983
  99,481,367
  99,481,649
  99,482,201
  99,482,485
  99,482,486
  99,483,512
  99,483,576
  99,483,625
  99,483,627
  99,484,279
  99,484,790
  99,484,797
  99,484,847
  99,485,046
  99,485,162
  99,486,050
  99,486,384
  99,486,436
  99,486,721
  99,486,741
  99,487,215
  99,487,399
  99,487,765
  99,487,958
  99,488,003
  99,488,439
  99,488,676
  99,489,161
  99,489,782
  99,490,340
  99,490,717
  99,490,866
  99,491,111
  99,491,581
  99,491,604
  99,492,018
  99,492,210
  99,492,393
  99,492,519
  99,492,996
  99,493,690
  99,494,003
  99,494,267
  99,494,765
  99,494,766
  99,494,892
  99,494,916
  99,495,024
  99,495,373
  99,495,516
  99,496,082
  99,496,648
  99,496,875
  99,497,190
  99,497,525
  99,497,694
  99,498,209
  99,498,318
  99,498,523
  99,498,526
  99,498,548
  99,499,433
  99,499,699
  99,499,892
  99,501,345
  99,501,567
  99,501,674
  99,502,260
  99,502,468
  99,504,818
  99,504,820
  99,505,995
  99,506,861
  99,508,004
  99,509,656
  99,510,621
  99,512,142
  99,513,051
  99,513,052
  99,513,302
  99,513,306
  99,513,402
  99,517,144
  99,518,542
  99,519,736
  99,522,278
  99,523,574
  99,523,952
  99,525,020
  99,525,557
  99,527,614
  99,527,882
  99,528,002
  99,528,530
  99,531,844
  99,533,306
  99,534,299
  99,534,937
  99,535,867
  99,536,039
  99,536,065
  99,537,284
  99,537,345
  99,541,112
  99,541,665
  99,543,163
  99,543,306
  99,543,881
  99,544,992
  99,545,601
  99,545,645
  99,546,100
  99,546,218
  99,546,683
  99,546,996
  99,548,760
  99,549,175
  99,549,245
  99,549,378
  99,550,798
  99,550,803
  99,551,126
  99,552,169
  99,552,199
  99,552,658
  99,553,614
  99,554,475
  99,554,487
  99,554,521
  99,554,531
  99,554,555
  99,554,556
  99,554,560
  99,554,568
  99,555,457
  99,557,879
2
A
C
T
-
A
-
G
C
97
G
G
A
C
-
T
C
A
G
A
C
A
G
2
G
-
T
T
A
G
C
G
G
-
C
5
23
T
-
C
-
-
G
T
T
G
A
-
C
A
C
-/4
-
A
G
5
C
G
T
G
A
C
2
-
-
C
G
A
-
-
-
T
G
G
C
T
C
2
T
G
2
T
3
GGT/GGTGT
A
G
-
T
A
G
G
G
C
T
A
TG/TGG
11/C
-/A
7
A
-/6
-/4
C
C
G
C
T
A
A
G
G
G
13
A
-
A
G
T
A
T
T
G
G
AAAAAAAAG/AAAAAAAAAG
G
2
G
G
C
C
A
A
A
G
-
A
A
8
3
G
-
T
C
C
A
G
TACACACACAC/TACACACACACAC
A
G
T
2
T
C
13
2
T
C
A
A
2/T
CGATGATGATGATGATGAT/CGATGATGACGATGATGATGACGATGATGATGATGAT
-
-/8
-/6
C
G
A
G
-
3/T
-/16
-/14
2
2
T
T
3
T
C
19
A
G
G
-
T
-
7
G
2
G
A
A
G
C
61
-
A
G
T
A
T
A
-
-
C
TA/TAA
2
A
3/A
-/A
C
-
-
5
C
T
A
G
3
-
G
-
-
C
A
A
130
G
2