Home     Edit Strains     Edit Gene List     Sequence Annotation
   

Chromosome Start Position Stop Position
Region Size: 11,835 (bp)   Positions: 7
Conservation 
Genes ( + ) 
Genes ( - ) 
Rnor 5.0  
0
--
--
--
0
.134
.046
--
--
--
--
--
--
--
T
A
G
2
A
A
G
  17,137,675
  17,138,615
  17,139,051
  17,139,052
  17,143,311
  17,144,932
  17,145,985
C
ATGTGTGTGTGTGTGTGTGTG/ATGTGTGTGTGTGTGTGTGTGTG
3/G
-/2
G
AAGAGAGAG/AAGAGAGAGAG
A