Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Ontology Browser

Term:
5'-GsCsCsGsAsGsGsTsCsCsAsTsGsTsCsGsTsAsCsGsC-3' (CHEBI:76689)
Annotations: Rat: (0) Mouse: (0) Human: (0) Chinchilla: (0) Bonobo: (0) Dog: (0) Squirrel: (0) Pig: (0)
Parent Terms Term With Siblings Child Terms
(4-hydroxy-3-iodo-5-nitrophenyl)acetic acid +  
1,2-di-O-myristoyl-sn-glycero-3-phosphocholine 
1,2-di-O-myristoyl-sn-glycero-3-phosphosulfocholine 
1-O-(alpha-D-galactopyranosyl)-N-icosa-11,14-dienoylphytosphingosine 
1-O-(alpha-D-galactopyranuronosyl)-N-tetradecanoyldihydrosphingosine 
1-O-(alpha-D-galactosyl)-N-hexacosanoylphytosphingosine +   
1-O-(alpha-D-glucosyl)-N-hexacosanoylphytosphingosine 
1-O-(alpha-lactosyl)-N-hexacosanoylphytosphingosine 
1-O-[alpha-D-galactosyl-(1->2)-alpha-D-galactosyl]-N-hexacosanoylphytosphingosine 
1-O-linoleoyl-2-O-oleoyl-3-O-alpha-D-galactosyl-sn-glycerol 
2-O-(alpha-D-mannopyranosyl)-1-phosphatidyl-1D-myo-inositol 
2-O-oleoyl-3-O-palmitoyl-1-O-alpha-D-galactosyl-sn-glycerol 
3-alpha-D-glucuronosyl-2-[(10R)-10-methyloctadecanoyl]-1-palmitoyl-sn-glycerol 
3-alpha-D-glucuronosyl-2-palmitoyl-1-[(10R)-10-methyloctadecanoyl]-sn-glycerol 
3-alpha-D-glucuronosyl-2-palmitoyl-1-stearoyl-sn-glycerol 
3-O-hydroxyphthioceranoyl-2-O-stearoyl-2'-O-sulfo-alpha,alpha-trehalose 
5'-AsGsCsCsGsCsGsAsCsTsTsCsTsAsGsAsCsT-3' 
5'-CsGsGsCsTsCsCsAsTsGsTsAsCsAsGsCsAsTsGsCsG-3' 
5'-GsCsAsGsTsCsTsAsTsTsAsCsTsGsTsGsCsGsAsGsA-3' 
5'-GsCsCsGsAsGsGsTsCsCsAsTsGsTsCsGsTsAsCsGsC-3' 
A phosphorothioate oligonucleotide consisting of seven deoxyguanosine, seven deoxycytidine, three deoxyadenosine and four thymidine residues connected by 3'->5' phosphorothioate linkages in the sequence G-C-C-G-A-G-G-T-C-C-A-T-G-T-C-G-T-A-C-G-C.
5'-GsCsGsTsAsCsGsAsCsAsTsGsGsAsCsCsTsCsGsGsC-3' 
5'-TCAACC-3' 
5'-TsGsTsGsGsGsTsTsAsAsGsAsCsTsTsTsTsTsAsCsC-3' 
5-(2-oxoethylideneamino)-6-D-ribitylaminouracil 
5-(2-oxopropylideneamino)-6-D-ribitylaminouracil 
6-deoxy-D-glucos-6-yl corynomycolate +  
6-O-(1-O-stearoyl-sn-glycero-3-phosphono)-1D-myo-inositol 
[->2)-beta-Man-(1->2)-alpha-Man-(1->2)-[alpha-Glc-(1->3)]-alpha-Man(1->2)-alpha-Man(1->3)-beta-GlcNAc-(1->]2 
[3)-alpha-D-Fucp-(1->2)-beta-L-Rhap-(1->]n 
A. haemolyticus strain 57 O-specific polysaccharide 
A. haemolyticus strain 61 O-specific polysaccharide 
acetyl cardiolipin 
acetyl-GPL-2 
alpha-D-galactosyl-(1->3)-D-galactose +  
alpha-D-galactosyl-(1->4)-beta-D-galactosyl-(1->4)-beta-D-glucosylceramide +   
alpha-D-GalN-(1->4)-[alpha-LD-Hep-(1->2)-alpha-DD-Hep-(1->2)]-alpha-D-GalA-yl group 
alpha-D-GalNAc-(1->3)-[alpha-L-Fuc-(1->2)]-beta-D-Gal-(1->3)-beta-D-GalNAc-(1->3)-alpha-D-Gal-(1->4)-beta-D-Gal-(1->4)-beta-D-Glc-(1->1')-Cer 
alpha-D-GalNpAc-(1->3)-beta-D-GalpNAc 
alpha-D-GalpNAc-(1->3)-[alpha-L-Fucp-(1->2)]-beta-D-Galp +  
alpha-D-GalpNAc-(1->3)-[alpha-L-Fucp-(1->2)]-beta-D-Galp-(1->3)-alpha-D-GalpNAc +  
alpha-D-GalpNAc-(1->3)-[alpha-L-Fucp-(1->2)]-beta-D-Galp-(1->3)-beta-D-GalpNAc +  
alpha-D-GalpNAc-(1->3)-[alpha-L-Fucp-(1->2)]-beta-D-Galp-(1->3)-D-GlcpNAc +  
alpha-D-GalpNAc-(1->3)-[alpha-L-Fucp-(1->2)]-beta-D-Galp-(1->4)-D-GlcpNAc +  
alpha-D-GlcpNAc-(1->2)-L-alpha-D-Hepp-(1->3)-L-alpha-D-Hepp 
alpha-D-Kdo-(2->4)-alpha-D-Kdo-(2->4)-alpha-D-Kdo-(2->6)-beta-D-GlcN4P-(1->6)-alpha-D-GlcN1P 
alpha-D-Kdo-(2->4)-alpha-D-Kdo-(2->6)-beta-D-GlcN-4P-(1->6)-alpha-D-GlcN-1P 
alpha-D-Kdo-(2->8)-alpha-D-Kdo-(2->4)-alpha-D-Kdo-(2->6)-beta-D-GlcN-4P-(1->6)-alpha-D-GlcN-1P 
alpha-Kdo-(2->4)-alpha-Kdo-OAll 
alpha-Kdo-(2->8)-alpha-7-O-Me-Kdo 
alpha-Kdo-(2->8)-alpha-Kdo-(2->4)-alpha-Kdo-OAll 
alpha-Kdo-(2->8)-alpha-Kdo-OAll 
alpha-Kdo-CH2OH-(2->4)-alpha-Kdo 
alpha-L-Fuc-(1->2)-[alpha-D-Gal-(1->3)]-beta-D-Gal-(1->3)-beta-D-GlcNAc-(1->3)-alpha-D-Gal-yl group 
alpha-L-Fuc-(1->2)-[alpha-D-GalNAc-(1->3)]-beta-D-Gal-(1->3)-beta-D-GlcNAc-(1->3)-alpha-D-Gal-yl group 
alpha-L-Fuc-(1->2)-beta-D-Gal-(1->3)-beta-D-GlcNAc-(1->3)-alpha-D-Gal-yl group 
alpha-L-Fuc-(1->2)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->3)-alpha-D-Gal-yl group 
alpha-L-Fuc-(1->3)-[beta-D-Gal-(1->4)]-beta-D-GlcNAc-(1->3)-beta-D-Gal-(1->3)-beta-D-GalNAc-(1->4)-[alpha-NeuAc-(2->3)]-beta-D-Gal-(1->4)-beta-D-Glc-(1<->1')-Cer 
alpha-L-Fucp-(1->2)-beta-D-Galp-(1->3)-[alpha-L-Fucp-(1->4)]-D-GlcNAc +  
alpha-L-Fucp-(1->2)-beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-beta-D-GlcpNAc +  
alpha-L-Fucp-(1->2)-beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-beta-D-GlcpNAc-(1->3)-D-Galp +  
alpha-L-Fucp-(1->2)-beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-D-GlcpNAc +  
alpha-L-Fucp-(1->3)-[beta-D-Galp-(1->4)]-D-GlcpNAc +  
alpha-L-Rhap-(1->3)-[alpha-D-Glcp-(1->4)]-alpha-L-Rhap-(1->3)-beta-D-GlcpNAc 
alpha-L-Rhap-(1->3)-[alpha-D-Glcp-(1->4)]-alpha-L-Rhap-(1->3)-beta-D-GlcpNAc-(1->2)-alpha-L-Rhap 
alpha-N-acetylneuraminosyl-(2->3)-[beta-D-galactosyl-(1->3)-N-acetyl-beta-D-galactosaminyl-(1->4)]-beta-D-galactosyl-(1->4)-beta-D-glucosyl-(1<->1')-N-acylsphingosine +   
alpha-N-acetylneuraminyl-(2->3)-beta-D-galactosyl-(1->4)-beta-D-glucosyl-(1<->1')-ceramide +  
alpha-Neu4Ac5Gc-(2->3)-beta-D-Galp-(1->4)-beta-D-Glcp-(1<->1')-Cer 
alpha-Neu5Gc-(2->3)-beta-D-Galp-(1->4)-beta-D-Glcp-(1<->1')-Cer 
alpha-Neu5Gc-(2->3)-beta-D-Galp-(1->4)-beta-D-GlcpNAc-(1->3)-beta-D-Galp-(1->4)-GlcpNAc-(1->3)-beta-D-Galp-(1->4)-beta-D-Glcp-(1<->1')-Cer 
alpha-Neup5Ac-(2->3)-beta-D-Galp-(1->3)-beta-D-GalpNAc-(1->3)-alpha-D-Galp-(1->4)-beta-D-Galp-(1->4)-beta-D-Glcp 
benzyl cinnamate  
beta-D-Gal-(1->3)-beta-D-GalNAc-(1->4)-[alpha-Neu5Gc-(2->3)]-beta-D-Gal-(1->4)-beta-D-Glc-(1<->1')-Cer 
beta-D-Galp-(1->3)-[alpha-L-Fucp-(1->4)]-D-GlcpNAc +  
beta-D-Galp-(1->3)-beta-D-GalpNAc-(1->3)-alpha-D-Galp-(1->4)-beta-D-Galp-(1->4)-beta-D-Glcp 
beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-beta-D-GlcpNAc-(1->3)-beta-D-Galp 
beta-D-Galp-(1->4)-beta-D-Glcp-(1->6)-[beta-D-Glcp-(1->4)]-beta-D-GlcpNAcOCH2CH2N3 
beta-D-GlcA-(1->3)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->3)-beta-D-Gal-(1->4)-beta-D-Glc-(1<->1')-Cer 
beta-D-GlcpA-(1->4)-beta-D-Glcp-(1->3)-beta-D-GlcpA-(1->4)-beta-D-GlcpOCH2CH2N3 
Brucella O-antigen 
Brucella sp. O-PS A-antigen 
Brucella sp. O-PS M-antigen 
C80 D-glucose mono(keto-meromycolate) 
colanic acid 
d(Gs)19dG 
DDM-838 
dimethyl cardiolipin 
diphosphatidyl propylene glycol 
E. coli 180/C3 O-specific polysaccharide 
E. coli O5:K4:H4 O-specific polysaccharide 
E. coli O65:K-:H- O-specific polysaccharide 
enterobacterial common antigen 
fluorescein isothiocyanate +   
ganglioside GM2 (18:0) +  
glucose 6-monomycolate (C85) 
glucuronoxylomannan  
glycerol mono(keto-meromycolate) 
glycerol monomycolate (C85) 
GPL C-II 
GPL P-I 
GPL P-II 
GPL P-IV 
GPL-1 
GPL-21 
GPL-25 
GPL-26 
GPL-4 
GPL-8 
GPL-9I 
immunogen +  
isopentenyl diphosphate  
K antigen 
keto-meromycolic acid +  
lactogangliotetraosylceramide 
lipoarabinomannan  
N(6)-acetyl-N(2)-(5'-phosphonatopyridoxyl)-L-lysinate(2-) 
N(6)-acetyl-N(2)-(5'-phosphopyridoxyl)-L-lysine 
N(6)-carboxymethyl-L-lysine +  
N-(5'-phosphonatopyridoxyl)-D-alaninate(2-) 
N-(5'-phosphonatopyridoxyl)-L-alaninate(2-) 
N-(5'-phosphopyridoxyl)-L-alanine 
N-[(2S,3S,4R)-1-(alpha-D-galactosyloxy)-3,4-dihydroxyoctadecan-2-yl]hexacosanethioamide 
N-acetyl-beta-D-galactosaminyl-(1->3)-alpha-D-galactosyl-(1->4)-beta-D-galactosyl-(1->4)-beta-D-glucosylceramide +  
N-glycoloyl-beta-neuraminic acid 
N-hexacosanoylisoglobotriaosyl ceramide 
P. aeruginosa immunotype 3 O-specific polysaccharide 
P. mirabilis 9B-m O-specific polysaccharide 
P. mirabilis O11 O-specific polysaccharide 
P. mirabilis O23 O-deacetylated O-specific polysaccharide 
P. mirabilis O24 O-specific polysaccharide 
P. mirabilis O29 O-specific polysaccharide 
P. mirabilis O43 O-specific polysaccharide 
P. mirabilis O6 O-specific polysaccharide 
P. stuartii O4 O-specific polysaccharide 
Para-LP-01 
phosphatidylinositol mannoside +  
phosphoantigen +   
PIM6 
Proteus genomospecies 3J-r O-specific polysaccharide 
ribothymidine +  
S. flexneri serotype 1a O-polysaccharide (O factor 9-negative) 
S. flexneri serotype 1a O-polysaccharide (O factor 9-positive) 
S. flexneri serotype 1b O-polysaccharide (O factor 9-positive) 
S. flexneri serotype 2a O-polysaccharide (O factor 9-negative) 
S. flexneri serotype 2a O-polysaccharide (O factor 9-positive) 
S. flexneri serotype 2a O-specific polysaccharide 
S. flexneri serotype 2b O-specific polysaccharide 
S. flexneri serotype 3a O-specific polysaccharide 
S. flexneri serotype 5a O-polysaccharide (O factor 9-negative) 
S. flexneri serotype 5a O-polysaccharide (O factor 9-positive) 
S. flexneri serotype 5a O-specific polysaccharide 
S. flexneri serotype 5b O-specific polysaccharide 
S. flexneri serotype 6 O-polysaccharide (O factor 9-positive) 
S. flexneri serotype X O-specific polysaccharide 
S. flexneri serotype Y O-polysaccharide (O factor 9-negative) 
S. flexneri serotype Y O-polysaccharide (O factor 9-positive) 
tetraoleyl cardiolipin 
tumour antigen +  
xenoantigen +  

Synonyms
Related Synonyms: Formula=C203H257N79O105P20S20 ;   InChI=1S/C203H257N79O105P20S20/c1-78-40-269(200(303)258-175(78)285)138-27-90(113(357-138)54-336-404(323,424)385-100-37-149(280-75-234-159-172(280)248-190(218)255-183(159)293)367-123(100)64-346-407(326,427)387-102-39-151(282-77-236-161-174(282)250-192(220)257-185(161)295)366-122(102)63-345-405(324,425)382-96-33-144(275-70-229-154-164(213)223-67-226-167(154)275)361-117(96)58-340-406(325,426)386-101-38-150(281-76-235-160-173(281)249-191(219)256-184(160)294)364-120(101)61-343-394(313,414)372-87-24-135(266-16-9-128(208)241-197(266)300)351-107(87)48-329-390(309,410)369-84-21-132(263-13-6-125(205)238-194(263)297)349-105(84)46-328-389(308,409)368-83-20-145(347-103(83)44-283)276-71-230-155-168(276)244-186(214)251-179(155)289)375-396(315,416)331-49-108-85(22-133(352-108)264-14-7-126(206)239-195(264)298)370-391(310,411)330-47-106-86(23-134(350-106)265-15-8-127(207)240-196(265)299)371-392(311,412)338-56-115-95(32-143(359-115)274-69-228-153-163(212)222-66-225-166(153)274)381-401(320,421)334-52-111-93(30-141(355-111)272-43-81(4)178(288)261-203(272)306)378-399(318,419)344-62-121-99(36-148(365-121)279-74-233-158-171(279)247-189(217)254-182(158)292)384-403(322,423)335-53-112-91(28-139(356-112)270-41-79(2)176(286)259-201(270)304)376-397(316,417)332-50-109-88(25-136(353-109)267-17-10-129(209)242-198(267)301)373-395(314,415)342-60-119-98(35-147(363-119)278-73-232-157-170(278)246-188(216)253-181(157)291)383-402(321,422)337-55-114-92(29-140(358-114)271-42-80(3)177(287)260-202(271)305)377-398(317,418)339-57-116-94(31-142(360-116)273-68-227-152-162(211)221-65-224-165(152)273)380-400(319,420)333-51-110-89(26-137(354-110)268-18-11-130(210)243-199(268)302)374-393(312,413)341-59-118-97(34-146(362-118)277-72-231-156-169(277)245-187(215)252-180(156)290)379-388(307,408)327-45-104-82(284)19-131(348-104)262-12-5-124(204)237-193(262)296/h5-18,40-43,65-77,82-123,131-151,283-284H,19-39,44-64H2,1-4H3,(H,307,408)(H,308,409)(H,309,410)(H,310,411)(H,311,412)(H,312,413)(H,313,414)(H,314,415)(H,315,416)(H,316,417)(H,317,418)(H,318,419)(H,319,420)(H,320,421)(H,321,422)(H,322,423)(H,323,424)(H,324,425)(H,325,426)(H,326,427)(H2,204,237,296)(H2,205,238,297)(H2,206,239,298)(H2,207,240,299)(H2,208,241,300)(H2,209,242,301)(H2,210,243,302)(H2,211,221,224)(H2,212,222,225)(H2,213,223,226)(H,258,285,303)(H,259,286,304)(H,260,287,305)(H,261,288,306)(H3,214,244,251,289)(H3,215,245,252,290)(H3,216,246,253,291)(H3,217,247,254,292)(H3,218,248,255,293)(H3,219,249,256,294)(H3,220,250,257,295)/t82-,83-,84-,85-,86-,87-,88-,89-,90-,91-,92-,93-,94-,95-,96-,97-,98-,99-,100-,101-,102-,103+,104+,105+,106+,107+,108+,109+,110+,111+,112+,113+,114+,115+,116+,117+,118+,119+,120+,121+,122+,123+,131+,132+,133+,134+,135+,136+,137+,138+,139+,140+,141+,142+,143+,144+,145+,146+,147+,148+,149+,150+,151+,388?,389?,390?,391?,392?,393?,394?,395?,396?,397?,398?,399?,400?,401?,402?,403?,404?,405?,406?,407?/m0/s1 ;   InChIKey=CWUDNXPMFGZWHT-WIHGMNDKSA-N ;   SMILES=Cc1cn([C@H]2C[C@H](OP(S)(=O)OC[C@H]3O[C@H](C[C@@H]3OP(S)(=O)OC[C@H]3O[C@H](C[C@@H]3OP(S)(=O)OC[C@H]3O[C@H](C[C@@H]3OP(S)(=O)OC[C@H]3O[C@H](C[C@@H]3O)n3ccc(N)nc3=O)n3cnc4c3nc(N)[nH]c4=O)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)[C@@H](COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3CO)n3cnc4c3nc(N)[nH]c4=O)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c(N)ncnc34)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c3nc(N)[nH]c4=O)n3cc(C)c(=O)[nH]c3=O)n3ccc(N)nc3=O)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3cc(C)c(=O)[nH]c3=O)n3cnc4c3nc(N)[nH]c4=O)n3cc(C)c(=O)[nH]c3=O)n3ccc(N)nc3=O)n3cnc4c3nc(N)[nH]c4=O)O2)c(=O)[nH]c1=O ;   [All-PS]-d(GCCGAGGTCCATGTCGTACGC) ;   [PS]-5'-GCCGAGGTCCATGTCGTACGC-3' ;   d[GPSCPSCPSGPSAPSGPSGPSTPSCPSCPSAPSTPSGPSTPSCPSGPSTPSAPSCPSGPSC] ;   phosphorothioate-linked 5'-GCC GAG GTC CAT GTC GTA CGC-3' ;   phosphorothioate-linked 5'-GCCGAGGTCCATGTCGTA CGC-3'
Xrefs: PMID:10199390

paths to the root

NHLBI Logo

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.