Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Ontology Browser

Term:
5'-GsCsAsGsTsCsTsAsTsTsAsCsTsGsTsGsCsGsAsGsA-3' (CHEBI:76700)
Annotations: Rat: (0) Mouse: (0) Human: (0) Chinchilla: (0) Bonobo: (0) Dog: (0) Squirrel: (0) Pig: (0)
Parent Terms Term With Siblings Child Terms
(4-hydroxy-3-iodo-5-nitrophenyl)acetic acid +  
1,2-di-O-myristoyl-sn-glycero-3-phosphocholine 
1,2-di-O-myristoyl-sn-glycero-3-phosphosulfocholine 
1-O-(alpha-D-galactopyranosyl)-N-icosa-11,14-dienoylphytosphingosine 
1-O-(alpha-D-galactopyranuronosyl)-N-tetradecanoyldihydrosphingosine 
1-O-(alpha-D-galactosyl)-N-hexacosanoylphytosphingosine +   
1-O-(alpha-D-glucosyl)-N-hexacosanoylphytosphingosine 
1-O-(alpha-lactosyl)-N-hexacosanoylphytosphingosine 
1-O-[alpha-D-galactosyl-(1->2)-alpha-D-galactosyl]-N-hexacosanoylphytosphingosine 
1-O-linoleoyl-2-O-oleoyl-3-O-alpha-D-galactosyl-sn-glycerol 
2-O-(alpha-D-mannopyranosyl)-1-phosphatidyl-1D-myo-inositol 
2-O-oleoyl-3-O-palmitoyl-1-O-alpha-D-galactosyl-sn-glycerol 
3-alpha-D-glucuronosyl-2-[(10R)-10-methyloctadecanoyl]-1-palmitoyl-sn-glycerol 
3-alpha-D-glucuronosyl-2-palmitoyl-1-[(10R)-10-methyloctadecanoyl]-sn-glycerol 
3-alpha-D-glucuronosyl-2-palmitoyl-1-stearoyl-sn-glycerol 
3-O-hydroxyphthioceranoyl-2-O-stearoyl-2'-O-sulfo-alpha,alpha-trehalose 
5'-AsGsCsCsGsCsGsAsCsTsTsCsTsAsGsAsCsT-3' 
5'-CsGsGsCsTsCsCsAsTsGsTsAsCsAsGsCsAsTsGsCsG-3' 
5'-GsCsAsGsTsCsTsAsTsTsAsCsTsGsTsGsCsGsAsGsA-3' 
A phosphorothioate oligonucleotide consisting of six deoxyguanosine, four deoxycytidine, five deoxyadenosine and six thymidine residues connected by 3'->5' phosphorothioate linkages in the sequence G-C-A-G-T-C-T-A-T-T-A-C-T-G-T-G-C-G-A-G-A.
5'-GsCsCsGsAsGsGsTsCsCsAsTsGsTsCsGsTsAsCsGsC-3' 
5'-GsCsGsTsAsCsGsAsCsAsTsGsGsAsCsCsTsCsGsGsC-3' 
5'-TCAACC-3' 
5'-TsGsTsGsGsGsTsTsAsAsGsAsCsTsTsTsTsTsAsCsC-3' 
5-(2-oxoethylideneamino)-6-D-ribitylaminouracil 
5-(2-oxopropylideneamino)-6-D-ribitylaminouracil 
6-deoxy-D-glucos-6-yl corynomycolate +  
6-O-(1-O-stearoyl-sn-glycero-3-phosphono)-1D-myo-inositol 
[->2)-beta-Man-(1->2)-alpha-Man-(1->2)-[alpha-Glc-(1->3)]-alpha-Man(1->2)-alpha-Man(1->3)-beta-GlcNAc-(1->]2 
[3)-alpha-D-Fucp-(1->2)-beta-L-Rhap-(1->]n 
A. haemolyticus strain 57 O-specific polysaccharide 
A. haemolyticus strain 61 O-specific polysaccharide 
acetyl cardiolipin 
acetyl-GPL-2 
alpha-D-galactosyl-(1->3)-D-galactose +  
alpha-D-galactosyl-(1->4)-beta-D-galactosyl-(1->4)-beta-D-glucosylceramide +   
alpha-D-GalN-(1->4)-[alpha-LD-Hep-(1->2)-alpha-DD-Hep-(1->2)]-alpha-D-GalA-yl group 
alpha-D-GalNAc-(1->3)-[alpha-L-Fuc-(1->2)]-beta-D-Gal-(1->3)-beta-D-GalNAc-(1->3)-alpha-D-Gal-(1->4)-beta-D-Gal-(1->4)-beta-D-Glc-(1->1')-Cer 
alpha-D-GalNpAc-(1->3)-beta-D-GalpNAc 
alpha-D-GalpNAc-(1->3)-[alpha-L-Fucp-(1->2)]-beta-D-Galp +  
alpha-D-GalpNAc-(1->3)-[alpha-L-Fucp-(1->2)]-beta-D-Galp-(1->3)-alpha-D-GalpNAc +  
alpha-D-GalpNAc-(1->3)-[alpha-L-Fucp-(1->2)]-beta-D-Galp-(1->3)-beta-D-GalpNAc +  
alpha-D-GalpNAc-(1->3)-[alpha-L-Fucp-(1->2)]-beta-D-Galp-(1->3)-D-GlcpNAc +  
alpha-D-GalpNAc-(1->3)-[alpha-L-Fucp-(1->2)]-beta-D-Galp-(1->4)-D-GlcpNAc +  
alpha-D-GlcpNAc-(1->2)-L-alpha-D-Hepp-(1->3)-L-alpha-D-Hepp 
alpha-D-Kdo-(2->4)-alpha-D-Kdo-(2->4)-alpha-D-Kdo-(2->6)-beta-D-GlcN4P-(1->6)-alpha-D-GlcN1P 
alpha-D-Kdo-(2->4)-alpha-D-Kdo-(2->6)-beta-D-GlcN-4P-(1->6)-alpha-D-GlcN-1P 
alpha-D-Kdo-(2->8)-alpha-D-Kdo-(2->4)-alpha-D-Kdo-(2->6)-beta-D-GlcN-4P-(1->6)-alpha-D-GlcN-1P 
alpha-Kdo-(2->4)-alpha-Kdo-OAll 
alpha-Kdo-(2->8)-alpha-7-O-Me-Kdo 
alpha-Kdo-(2->8)-alpha-Kdo-(2->4)-alpha-Kdo-OAll 
alpha-Kdo-(2->8)-alpha-Kdo-OAll 
alpha-Kdo-CH2OH-(2->4)-alpha-Kdo 
alpha-L-Fuc-(1->2)-[alpha-D-Gal-(1->3)]-beta-D-Gal-(1->3)-beta-D-GlcNAc-(1->3)-alpha-D-Gal-yl group 
alpha-L-Fuc-(1->2)-[alpha-D-GalNAc-(1->3)]-beta-D-Gal-(1->3)-beta-D-GlcNAc-(1->3)-alpha-D-Gal-yl group 
alpha-L-Fuc-(1->2)-beta-D-Gal-(1->3)-beta-D-GlcNAc-(1->3)-alpha-D-Gal-yl group 
alpha-L-Fuc-(1->2)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->3)-alpha-D-Gal-yl group 
alpha-L-Fuc-(1->3)-[beta-D-Gal-(1->4)]-beta-D-GlcNAc-(1->3)-beta-D-Gal-(1->3)-beta-D-GalNAc-(1->4)-[alpha-NeuAc-(2->3)]-beta-D-Gal-(1->4)-beta-D-Glc-(1<->1')-Cer 
alpha-L-Fucp-(1->2)-beta-D-Galp-(1->3)-[alpha-L-Fucp-(1->4)]-D-GlcNAc +  
alpha-L-Fucp-(1->2)-beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-beta-D-GlcpNAc +  
alpha-L-Fucp-(1->2)-beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-beta-D-GlcpNAc-(1->3)-D-Galp +  
alpha-L-Fucp-(1->2)-beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-D-GlcpNAc +  
alpha-L-Fucp-(1->3)-[beta-D-Galp-(1->4)]-D-GlcpNAc +  
alpha-L-Rhap-(1->3)-[alpha-D-Glcp-(1->4)]-alpha-L-Rhap-(1->3)-beta-D-GlcpNAc 
alpha-L-Rhap-(1->3)-[alpha-D-Glcp-(1->4)]-alpha-L-Rhap-(1->3)-beta-D-GlcpNAc-(1->2)-alpha-L-Rhap 
alpha-N-acetylneuraminosyl-(2->3)-[beta-D-galactosyl-(1->3)-N-acetyl-beta-D-galactosaminyl-(1->4)]-beta-D-galactosyl-(1->4)-beta-D-glucosyl-(1<->1')-N-acylsphingosine +   
alpha-N-acetylneuraminyl-(2->3)-beta-D-galactosyl-(1->4)-beta-D-glucosyl-(1<->1')-ceramide +  
alpha-Neu4Ac5Gc-(2->3)-beta-D-Galp-(1->4)-beta-D-Glcp-(1<->1')-Cer 
alpha-Neu5Gc-(2->3)-beta-D-Galp-(1->4)-beta-D-Glcp-(1<->1')-Cer 
alpha-Neu5Gc-(2->3)-beta-D-Galp-(1->4)-beta-D-GlcpNAc-(1->3)-beta-D-Galp-(1->4)-GlcpNAc-(1->3)-beta-D-Galp-(1->4)-beta-D-Glcp-(1<->1')-Cer 
alpha-Neup5Ac-(2->3)-beta-D-Galp-(1->3)-beta-D-GalpNAc-(1->3)-alpha-D-Galp-(1->4)-beta-D-Galp-(1->4)-beta-D-Glcp 
benzyl cinnamate  
beta-D-Gal-(1->3)-beta-D-GalNAc-(1->4)-[alpha-Neu5Gc-(2->3)]-beta-D-Gal-(1->4)-beta-D-Glc-(1<->1')-Cer 
beta-D-Galp-(1->3)-[alpha-L-Fucp-(1->4)]-D-GlcpNAc +  
beta-D-Galp-(1->3)-beta-D-GalpNAc-(1->3)-alpha-D-Galp-(1->4)-beta-D-Galp-(1->4)-beta-D-Glcp 
beta-D-Galp-(1->4)-[alpha-L-Fucp-(1->3)]-beta-D-GlcpNAc-(1->3)-beta-D-Galp 
beta-D-Galp-(1->4)-beta-D-Glcp-(1->6)-[beta-D-Glcp-(1->4)]-beta-D-GlcpNAcOCH2CH2N3 
beta-D-GlcA-(1->3)-beta-D-Gal-(1->4)-beta-D-GlcNAc-(1->3)-beta-D-Gal-(1->4)-beta-D-Glc-(1<->1')-Cer 
beta-D-GlcpA-(1->4)-beta-D-Glcp-(1->3)-beta-D-GlcpA-(1->4)-beta-D-GlcpOCH2CH2N3 
Brucella O-antigen 
Brucella sp. O-PS A-antigen 
Brucella sp. O-PS M-antigen 
C80 D-glucose mono(keto-meromycolate) 
colanic acid 
d(Gs)19dG 
DDM-838 
dimethyl cardiolipin 
diphosphatidyl propylene glycol 
E. coli 180/C3 O-specific polysaccharide 
E. coli O5:K4:H4 O-specific polysaccharide 
E. coli O65:K-:H- O-specific polysaccharide 
enterobacterial common antigen 
fluorescein isothiocyanate +   
ganglioside GM2 (18:0) +  
glucose 6-monomycolate (C85) 
glucuronoxylomannan  
glycerol mono(keto-meromycolate) 
glycerol monomycolate (C85) 
GPL C-II 
GPL P-I 
GPL P-II 
GPL P-IV 
GPL-1 
GPL-21 
GPL-25 
GPL-26 
GPL-4 
GPL-8 
GPL-9I 
immunogen +  
isopentenyl diphosphate  
K antigen 
keto-meromycolic acid +  
lactogangliotetraosylceramide 
lipoarabinomannan  
N(6)-acetyl-N(2)-(5'-phosphonatopyridoxyl)-L-lysinate(2-) 
N(6)-acetyl-N(2)-(5'-phosphopyridoxyl)-L-lysine 
N(6)-carboxymethyl-L-lysine +  
N-(5'-phosphonatopyridoxyl)-D-alaninate(2-) 
N-(5'-phosphonatopyridoxyl)-L-alaninate(2-) 
N-(5'-phosphopyridoxyl)-L-alanine 
N-[(2S,3S,4R)-1-(alpha-D-galactosyloxy)-3,4-dihydroxyoctadecan-2-yl]hexacosanethioamide 
N-acetyl-beta-D-galactosaminyl-(1->3)-alpha-D-galactosyl-(1->4)-beta-D-galactosyl-(1->4)-beta-D-glucosylceramide +  
N-glycoloyl-beta-neuraminic acid 
N-hexacosanoylisoglobotriaosyl ceramide 
P. aeruginosa immunotype 3 O-specific polysaccharide 
P. mirabilis 9B-m O-specific polysaccharide 
P. mirabilis O11 O-specific polysaccharide 
P. mirabilis O23 O-deacetylated O-specific polysaccharide 
P. mirabilis O24 O-specific polysaccharide 
P. mirabilis O29 O-specific polysaccharide 
P. mirabilis O43 O-specific polysaccharide 
P. mirabilis O6 O-specific polysaccharide 
P. stuartii O4 O-specific polysaccharide 
Para-LP-01 
phosphatidylinositol mannoside +  
phosphoantigen +   
PIM6 
Proteus genomospecies 3J-r O-specific polysaccharide 
ribothymidine +  
S. flexneri serotype 1a O-polysaccharide (O factor 9-negative) 
S. flexneri serotype 1a O-polysaccharide (O factor 9-positive) 
S. flexneri serotype 1b O-polysaccharide (O factor 9-positive) 
S. flexneri serotype 2a O-polysaccharide (O factor 9-negative) 
S. flexneri serotype 2a O-polysaccharide (O factor 9-positive) 
S. flexneri serotype 2a O-specific polysaccharide 
S. flexneri serotype 2b O-specific polysaccharide 
S. flexneri serotype 3a O-specific polysaccharide 
S. flexneri serotype 5a O-polysaccharide (O factor 9-negative) 
S. flexneri serotype 5a O-polysaccharide (O factor 9-positive) 
S. flexneri serotype 5a O-specific polysaccharide 
S. flexneri serotype 5b O-specific polysaccharide 
S. flexneri serotype 6 O-polysaccharide (O factor 9-positive) 
S. flexneri serotype X O-specific polysaccharide 
S. flexneri serotype Y O-polysaccharide (O factor 9-negative) 
S. flexneri serotype Y O-polysaccharide (O factor 9-positive) 
tetraoleyl cardiolipin 
tumour antigen +  
xenoantigen +  

Synonyms
Related Synonyms: Formula=C206H260N79O107P21S21 ;   InChI=1S/C206H260N79O107P21S21/c1-79-36-269(201(303)259-179(79)287)135-21-91(116(360-135)52-340-410(327,431)391-104-34-150(284-77-241-161-177(284)251-195(220)257-189(161)297)371-126(104)62-350-412(329,433)386-99-29-144(278-71-235-155-166(214)225-66-230-171(155)278)363-118(99)54-342-398(315,419)376-87-17-131(265-11-7-127(207)243-197(265)299)352-108(87)44-332-394(311,415)373-85-15-146(351-106(85)42-286)280-73-237-157-173(280)247-191(216)253-185(157)293)378-400(317,421)333-45-109-88(18-132(353-109)266-12-8-128(208)244-198(266)300)374-396(313,417)336-48-112-93(23-137(356-112)271-38-81(3)181(289)261-203(271)305)380-402(319,423)344-56-120-98(28-143(365-120)277-70-234-154-165(213)224-65-229-170(154)277)385-408(325,429)339-51-115-92(22-136(359-115)270-37-80(2)180(288)260-202(270)304)379-401(318,422)338-50-114-95(25-139(358-114)273-40-83(5)183(291)263-205(273)307)381-403(320,424)343-55-119-97(27-142(364-119)276-69-233-153-164(212)223-64-228-169(153)276)384-406(323,427)334-46-110-89(19-133(354-110)267-13-9-129(209)245-199(267)301)375-397(314,418)337-49-113-94(24-138(357-113)272-39-82(4)182(290)262-204(272)306)382-404(321,425)348-60-124-103(33-149(369-124)283-76-240-160-176(283)250-194(219)256-188(160)296)390-409(326,430)341-53-117-96(26-140(361-117)274-41-84(6)184(292)264-206(274)308)383-405(322,426)347-59-123-102(32-148(368-123)282-75-239-159-175(282)249-193(218)255-187(159)295)389-407(324,428)335-47-111-90(20-134(355-111)268-14-10-130(210)246-200(268)302)377-399(316,420)346-58-122-105(35-151(367-122)285-78-242-162-178(285)252-196(221)258-190(162)298)392-413(330,434)345-57-121-100(30-145(366-121)279-72-236-156-167(215)226-67-231-172(156)279)387-411(328,432)349-61-125-101(31-147(370-125)281-74-238-158-174(281)248-192(217)254-186(158)294)388-395(312,416)331-43-107-86(372-393(309,310)414)16-141(362-107)275-68-232-152-163(211)222-63-227-168(152)275/h7-14,36-41,63-78,85-126,131-151,286H,15-35,42-62H2,1-6H3,(H,311,415)(H,312,416)(H,313,417)(H,314,418)(H,315,419)(H,316,420)(H,317,421)(H,318,422)(H,319,423)(H,320,424)(H,321,425)(H,322,426)(H,323,427)(H,324,428)(H,325,429)(H,326,430)(H,327,431)(H,328,432)(H,329,433)(H,330,434)(H2,207,243,299)(H2,208,244,300)(H2,209,245,301)(H2,210,246,302)(H2,211,222,227)(H2,212,223,228)(H2,213,224,229)(H2,214,225,230)(H2,215,226,231)(H,259,287,303)(H,260,288,304)(H,261,289,305)(H,262,290,306)(H,263,291,307)(H,264,292,308)(H2,309,310,414)(H3,216,247,253,293)(H3,217,248,254,294)(H3,218,249,255,295)(H3,219,250,256,296)(H3,220,251,257,297)(H3,221,252,258,298)/t85-,86-,87-,88-,89-,90-,91-,92-,93-,94-,95-,96-,97-,98-,99-,100-,101-,102-,103-,104-,105-,106+,107+,108+,109+,110+,111+,112+,113+,114+,115+,116+,117+,118+,119+,120+,121+,122+,123+,124+,125+,126+,131+,132+,133+,134+,135+,136+,137+,138+,139+,140+,141+,142+,143+,144+,145+,146+,147+,148+,149+,150+,151+,394?,395?,396?,397?,398?,399?,400?,401?,402?,403?,404?,405?,406?,407?,408?,409?,410?,411?,412?,413?/m0/s1 ;   InChIKey=JCHAIEMOIIRGET-REKWKFFTSA-N ;   SMILES=Cc1cn([C@H]2C[C@H](OP(S)(=O)OC[C@H]3O[C@H](C[C@@H]3OP(S)(=O)OC[C@H]3O[C@H](C[C@@H]3OP(S)(=O)OC[C@H]3O[C@H](C[C@@H]3OP(S)(=O)OC[C@H]3O[C@H](C[C@@H]3OP(S)(=O)OC[C@H]3O[C@H](C[C@@H]3OP(S)(=O)OC[C@H]3O[C@H](C[C@@H]3OP(O)(S)=O)n3cnc4c(N)ncnc34)n3cnc4c3nc(N)[nH]c4=O)n3cnc4c(N)ncnc34)n3cnc4c3nc(N)[nH]c4=O)n3ccc(N)nc3=O)n3cnc4c3nc(N)[nH]c4=O)[C@@H](COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3COP(S)(=O)O[C@H]3C[C@@H](O[C@@H]3CO)n3cnc4c3nc(N)[nH]c4=O)n3ccc(N)nc3=O)n3cnc4c(N)ncnc34)n3cnc4c3nc(N)[nH]c4=O)n3cc(C)c(=O)[nH]c3=O)n3ccc(N)nc3=O)n3cc(C)c(=O)[nH]c3=O)n3cnc4c(N)ncnc34)n3cc(C)c(=O)[nH]c3=O)n3cc(C)c(=O)[nH]c3=O)n3cnc4c(N)ncnc34)n3ccc(N)nc3=O)n3cc(C)c(=O)[nH]c3=O)n3cnc4c3nc(N)[nH]c4=O)O2)c(=O)[nH]c1=O ;   [All-PS]-d(GCAGTCTATTACTGTGCGAGA) ;   [PS]-5'-GCAGTCTATTACTGTGCGAGA-3' ;   d[GPSCPSAPSGPSTPSCPSTPSAPSTPSTPSAPSCPSTPSGPSTPSGPSCPSGPSAPSGPSA] ;   phosphorothioate-linked 5'-GCA GTC TAT TAC TGT GCG AGA-3' ;   phosphorothioate-linked 5'-GCAGTCTATTACTGTGCGAGA-3'
Xrefs: PMID:10199390

paths to the root

NHLBI Logo

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.