Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   
Gene: Adamts16em1Bj (ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj) Rattus norvegicus
Analyze
Symbol: Adamts16em1Bj
Name: ADAM metallopeptidase with thrombospondin type 1 motif, 16; ZFN mutant1,Bj
Description: This allele was induced by injecting ZFNs target sequence CCGCGGTTGCTTTGCGCTCTGGGTGCTGTTGCTGGCGCA into Dahl S rat eggs as . The resulting mutation is a 17-bp deletion of the sequence gctctgggtgctgttgc in exon 1.
ASSOCIATED WITH decreased systemic arterial diastolic blood pressure; decreased systemic arterial systolic blood pressure; extended life span; ASSOCIATED WITH cryptorchidism; hypertension; male infertility
Type: allele  of Adamts16  
Also known as: Adamts16em1Bj; Adamts16em1Bj
Is Marker For: Strains:   SS-Adamts16em1Bj  
Latest Assembly: Rnor_6.0 - RGSC Genome Assembly v6.0
Position: No map positions available.


Disease Annotations
Phenotype Annotations
References - curated

Genomics

Related Rat Strains

Expression


Sequence

Nucleotide Sequences

Additional Information

Nomenclature History
 
More on Adamts16em1Bj
Alliance Gene
Ensembl Gene
NCBI Genome Data Viewer

CRRD Object Information
CRRD ID: 13437613
Created: 2017-10-10
Species: Rattus norvegicus
Last Modified: 2017-10-10
Status: ACTIVE



NHLBI Logo

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.