MIR2861 (microRNA 2861) - Chinchilla Research Resource Database

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

Gene: MIR2861 (microRNA 2861) Homo sapiens

Analyze

General
Array IDs
References

Symbol:

MIR2861

Name:

microRNA 2861

Description:

Implicated in osteoporosis.

Type:

ncrna

RefSeq Status:

REVIEWED

Also known as:

BMND15; MIRN2861

Orthologs:

Mus musculus (house mouse) : Mir2861 (microRNA 2861) MGI

more info ...

Species	Gene symbol and name	Data Source	Assertion derived from	less info ...
Orthologs ¹				less info ...
Mus musculus (house mouse):	Mir2861 (microRNA 2861)	HGNC	HGNC

Allele / Splice:

See ClinVar data

Latest Assembly:

GRCh38 - Human Genome Assembly GRCh38

Position:

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	9	127,785,918 - 127,786,007 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	9	130,548,197 - 130,548,286 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Celera	9	101,199,060 - 101,199,149 (+)	NCBI
Cytogenetic Map	9	q34.11	NCBI
HuRef	9	100,164,466 - 100,164,555 (+)	NCBI		HuRef
CHM1_1	9	130,699,746 - 130,699,835 (+)	NCBI		CHM1_1

JBrowse:

View Region in Genome Browser (JBrowse)

Model

Annotation (Toggle Annotation Detail/Summary View)

Disease Annotations

Imported Annotations - ClinVar

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
congenital disorder of glycosylation Iu		IAGP	RGD:14702060	8554872	ClinVar Annotator: match by term: Congenital disorder of glycosylation type 1u	ClinVar	PMID:28492532
early infantile epileptic encephalopathy		IAGP	RGD:14701855	8554872	ClinVar Annotator: match by term: Early infantile epileptic encephalopathy	ClinVar	PMID:18469812 more ...
osteoporosis		IAGP	RGD:8555442	8554872	ClinVar Annotator: match by term: Bone mineral density quantitative trait locus 15	ClinVar	PMID:19920351

Imported Annotations - OMIM

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
osteoporosis		IAGP		7240710		OMIM

Gene-Chemical Interaction Annotations

Term	Qualifier	Evidence	With	Reference	Notes	Source	Original Reference(s)
icariin	decreases expression	ISO	RGD:4888705	6480464	icariin results in decreased expression of MIR2861 mRNA	CTD	PMID:30533443

Disease Annotations

	congenital disorder of glycosylation Iu (IAGP)
	early infantile epileptic encephalopathy (IAGP)

osteoporosis (IAGP)

Gene-Chemical Interaction Annotations

icariin (ISO)

References - curated

1.	OMIM Disease Annotation Pipeline
2.	RGD automated import pipeline for ClinVar variants, variant-to-disease annotations and gene-to-disease annotations

References - uncurated

PubMed

16381832 19920351 23609190 26656154 28078846 28961259 29620443 30940310

Genomics

Comparative Map Data

MIR2861
(Homo sapiens - human)

Human Assembly	Chr	Position (strand)	Source	Genome Browsers
Human Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCh38	9	127,785,918 - 127,786,007 (+)	NCBI	GRCh38	GRCh38	hg38	GRCh38
GRCh37	9	130,548,197 - 130,548,286 (+)	NCBI	GRCh37	GRCh37	hg19	GRCh37
Celera	9	101,199,060 - 101,199,149 (+)	NCBI
Cytogenetic Map	9	q34.11	NCBI
HuRef	9	100,164,466 - 100,164,555 (+)	NCBI		HuRef
CHM1_1	9	130,699,746 - 130,699,835 (+)	NCBI		CHM1_1

Mir2861
(Mus musculus - house mouse)

Mouse Assembly	Chr	Position (strand)	Source	Genome Browsers
Mouse Assembly	Chr	Position (strand)	Source	JBrowse	NCBI	UCSC	Ensembl
GRCm38	2	32,712,807 - 32,712,888 (-)	NCBI	GRCm38	GRCm38	mm10	GRCm38
Celera	2	32,419,414 - 32,419,495 (-)	NCBI		Celera
Cytogenetic Map	2	B	NCBI
cM Map	2	22.09	NCBI

miRNA Target Status

Predicted Targets

	Summary Value
Count of predictions:	61446
Count of gene targets:	16256
Count of transcripts:	51908
Interacting mature miRNAs:	hsa-miR-2861
Prediction methods:	Microtar, Miranda, Pita, Pita,Targetscan, Rnahybrid, Targetscan
Result types:	miRGate_prediction

The detailed report is available here: Full Report CSV TAB Printer

miRNA Target Status data imported from miRGate (http://mirgate.bioinfo.cnio.es/).
For more information about miRGate, see PMID:25858286 or access the full paper here.

Expression

Sequence

Nucleotide Sequences

RefSeq Transcripts	NG_029812	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NG_033942	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	NR_036055	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AL162586	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

Reference Sequences

RefSeq Acc Id:

NR_036055

RefSeq Status:

REVIEWED

Type:

NON-CODING

Position:

Human Assembly	Chr	Position (strand)	Source
GRCh38	9	127,785,918 - 127,786,007 (+)	NCBI
GRCh37	9	130,548,197 - 130,548,286 (+)	RGD
Celera	9	101,199,060 - 101,199,149 (+)	RGD
HuRef	9	100,164,466 - 100,164,555 (+)	RGD
CHM1_1	9	130,699,746 - 130,699,835 (+)	NCBI

Sequence:

show sequence

GGCGCCTCTGCAGCTCCGGCTCCCCCTGGCCTCTCGGGAACTACAAGTCCCAGGGGGCCTGGCG
GTGGGCGGCGGGCGGAAGAGGCGGGG

hide sequence

Clinical Variants

Name	Type	Condition(s)	Position(s)	Clinical significance
NR_036055.1(MIR2861):n.33C>G	single nucleotide variant	Bone mineral density quantitative trait locus 15 [RCV000000126]	Chr9:127785950 [GRCh38] Chr9:130548229 [GRCh37] Chr9:9q34.11	association
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138179445)x3	copy number gain	Global developmental delay [RCV000050347]\|Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050348]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000050348]\|See cases [RCV000050348]	Chr9:193412..138179445 [GRCh38] Chr9:204193..141073897 [GRCh37] Chr9:194193..140193718 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9q33.2-34.3(chr9:121112395-138075224)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051009]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051009]\|See cases [RCV000051009]	Chr9:121112395..138075224 [GRCh38] Chr9:123874673..140969676 [GRCh37] Chr9:122914494..140089497 [NCBI36] Chr9:9q33.2-34.3	pathogenic
GRCh38/hg38 9q33.2-34.3(chr9:122792658-138124532)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051040]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000051040]\|See cases [RCV000051040]	Chr9:122792658..138124532 [GRCh38] Chr9:125554937..141018984 [GRCh37] Chr9:124594758..140138805 [NCBI36] Chr9:9q33.2-34.3	pathogenic
GRCh38/hg38 9q33.3-34.11(chr9:125993583-129682375)x1	copy number loss	Hepatomegaly [RCV000052923]\|Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052924]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000052924]\|See cases [RCV000052923]	Chr9:125993583..129682375 [GRCh38] Chr9:128755862..132444654 [GRCh37] Chr9:127795683..131484475 [NCBI36] Chr9:9q33.3-34.11	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138124532)x3	copy number gain	Intrauterine growth retardation [RCV000053745]\|See cases [RCV000053745]	Chr9:193412..138124532 [GRCh38] Chr9:204193..141018984 [GRCh37] Chr9:194193..140138805 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138114463)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053746]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053746]\|See cases [RCV000053746]	Chr9:193412..138114463 [GRCh38] Chr9:214367..141008915 [GRCh37] Chr9:204367..140128736 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138179445)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053748]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053748]\|See cases [RCV000053748]	Chr9:193412..138179445 [GRCh38] Chr9:266045..141073897 [GRCh37] Chr9:256045..140193718 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9q33.2-34.3(chr9:121586837-138179445)x3	copy number gain	Developmental Delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053776]\|Developmental delay and additional significant developmental and morphological phenotypes referred for genetic testing [RCV000053776]\|See cases [RCV000053776]	Chr9:121586837..138179445 [GRCh38] Chr9:124349116..141073897 [GRCh37] Chr9:123388937..140193718 [NCBI36] Chr9:9q33.2-34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:204193-138179445)	copy number gain	See cases [RCV000133791]	Chr9:204193..138179445 [GRCh38] Chr9:204193..141073897 [GRCh37] Chr9:194193..140193718 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9q33.2-34.3(chr9:121073102-138179445)x3	copy number gain	See cases [RCV000134920]	Chr9:121073102..138179445 [GRCh38] Chr9:123835380..141073897 [GRCh37] Chr9:122875201..140193718 [NCBI36] Chr9:9q33.2-34.3	pathogenic
GRCh38/hg38 9q33.3-34.11(chr9:125055865-128637946)x1	copy number loss	See cases [RCV000137787]	Chr9:125055865..128637946 [GRCh38] Chr9:127818144..131400225 [GRCh37] Chr9:126857965..130440046 [NCBI36] Chr9:9q33.3-34.11	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138124524)x3	copy number gain	See cases [RCV000138783]	Chr9:193412..138124524 [GRCh38] Chr9:204090..141018976 [GRCh37] Chr9:194090..140138797 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138159073)x3	copy number gain	See cases [RCV000138962]	Chr9:193412..138159073 [GRCh38] Chr9:204104..141053525 [GRCh37] Chr9:194104..140173346 [NCBI36] Chr9:9p24.3-q34.3	pathogenic\|conflicting data from submitters
GRCh38/hg38 9p11.2-q34.3(chr9:193412-138159073)x3	copy number gain	See cases [RCV000139207]	Chr9:193412..138159073 [GRCh38] Chr9:68420641..141053525 [GRCh37] Chr9:67910461..140173346 [NCBI36] Chr9:9p11.2-q34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:203861-138125937)x3	copy number gain	See cases [RCV000141876]	Chr9:203861..138125937 [GRCh38] Chr9:203861..141020389 [GRCh37] Chr9:193861..140140210 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:203862-138125937)x3	copy number gain	See cases [RCV000143476]	Chr9:203862..138125937 [GRCh38] Chr9:203862..141020389 [GRCh37] Chr9:193862..140140210 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh38/hg38 9p24.3-q34.3(chr9:193412-138179445)x3	copy number gain	See cases [RCV000148113]	Chr9:193412..138179445 [GRCh38] Chr9:204193..141073897 [GRCh37] Chr9:194193..140193718 [NCBI36] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:163131-141122114)x3	copy number gain	See cases [RCV000240081]	Chr9:163131..141122114 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:62525-141006407)	copy number gain	See cases [RCV000449375]	Chr9:62525..141006407 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:203861-141020389)x3	copy number gain	See cases [RCV000447207]	Chr9:203861..141020389 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9q33.3-34.11(chr9:129079208-130851795)x1	copy number loss	See cases [RCV000447376]	Chr9:129079208..130851795 [GRCh37] Chr9:9q33.3-34.11	pathogenic
GRCh37/hg19 9q33.3-34.3(chr9:128652785-141044751)x3	copy number gain	See cases [RCV000447080]	Chr9:128652785..141044751 [GRCh37] Chr9:9q33.3-34.3	pathogenic
GRCh37/hg19 9q34.11(chr9:130390139-132760275)x1	copy number loss	See cases [RCV000445837]	Chr9:130390139..132760275 [GRCh37] Chr9:9q34.11	pathogenic
GRCh37/hg19 9q33.2-34.3(chr9:124642754-141146461)x3	copy number gain	See cases [RCV000448784]	Chr9:124642754..141146461 [GRCh37] Chr9:9q33.2-34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:203864-141020389)x3	copy number gain	See cases [RCV000448978]	Chr9:203864..141020389 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9q21.11-34.3(chr9:71069743-140999928)	copy number gain	Global developmental delay [RCV000626548]\|Seizures [RCV000626548]	Chr9:71069743..140999928 [GRCh37] Chr9:9q21.11-34.3	likely pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:203862-141020389)	copy number gain	See cases [RCV000512392]	Chr9:203862..141020389 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:10590-141122247)x3	copy number gain	not provided [RCV000748055]	Chr9:10590..141122247 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9q33.3-34.12(chr9:129370440-133866894)x1	copy number loss	not provided [RCV000748671]	Chr9:129370440..133866894 [GRCh37] Chr9:9q33.3-34.12	pathogenic
GRCh37/hg19 9q33.3-34.11(chr9:129522693-131410039)x1	copy number loss	not provided [RCV000748677]	Chr9:129522693..131410039 [GRCh37] Chr9:9q33.3-34.11	benign
GRCh37/hg19 9p24.3-q34.3(chr9:10590-141107672)x3	copy number gain	not provided [RCV000748053]	Chr9:10590..141107672 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:46587-141066491)x3	copy number gain	not provided [RCV000748063]	Chr9:46587..141066491 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:10590-141114095)x2	copy number gain	not provided [RCV000748054]	Chr9:10590..141114095 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
GRCh37/hg19 9p24.3-q34.3(chr9:203861-141020388)x3	copy number gain	not provided [RCV000845900]	Chr9:203861..141020388 [GRCh37] Chr9:9p24.3-q34.3	pathogenic
NC_000009.11:g.(?_130374663)_(131329276_?)del	deletion	Early infantile epileptic encephalopathy [RCV000819894]	Chr9:127612384..128566997 [GRCh38] Chr9:130374663..131329276 [GRCh37] Chr9:9q34.11	pathogenic
GRCh37/hg19 9q21.11-34.3(chr9:71416475-141020389)x3	copy number gain	not provided [RCV000847808]	Chr9:71416475..141020389 [GRCh37] Chr9:9q21.11-34.3	pathogenic
NC_000009.11:g.(?_130216797)_(130953151_?)dup	duplication	Congenital disorder of glycosylation type 1u [RCV000821291]	Chr9:127454518..128190872 [GRCh38] Chr9:130216797..130953151 [GRCh37] Chr9:9q33.3-34.11	uncertain significance

Additional Information

External Database Links

Database	Acc Id	Source(s)
COSMIC	MIR2861	COSMIC
Ensembl Genes	ENSG00000284547	ENTREZGENE
Ensembl Transcript	ENST00000636310	ENTREZGENE
GTEx	ENSG00000284547	GTEx
HGNC ID	HGNC:38221	ENTREZGENE
Human Proteome Map	MIR2861	Human Proteome Map
miRBase	MI0013006	ENTREZGENE
NCBI Gene	100422910	ENTREZGENE
OMIM	613405	OMIM
	613418	OMIM
PharmGKB	PA165585840	PharmGKB
RNAcentral	URS00003B13B8	RNACentral
	URS000075ADBF	RNACentral

More on MIR2861
	Alliance Gene
	NCBI Gene
	Ensembl Gene
	JBrowse: hg19 hg38
	HGNC Report
	NCBI Genome Data Viewer

CRRD Object Information
CRRD ID:	4108998
Created:	2010-08-04
Species:	Homo sapiens
Last Modified:	2019-11-26
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.