D14Mit10 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D14Mit10

Symbol: D14Mit10
Also known as: IGFBP3; oxsts8883; 
CRRD ID: 10773
Expected Size: 260 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01487,458,772 - 87,459,035NCBIRnor6.0
Rnor_5.01481,093,112 - 81,093,375UniSTSRnor5.0
RGSC_v3.41487,960,278 - 87,960,541UniSTSRGSC3.4
RGSC_v3.41487,960,277 - 87,960,541RGDRGSC3.4
RGSC_v3.11487,979,422 - 87,979,686RGD
Celera1481,131,893 - 81,132,138UniSTS
Cytogenetic Map14q21UniSTS
RH 3.4 Map14602.4UniSTS
RH 3.4 Map14602.4RGD
RH 2.0 Map14719.4RGD
Is Marker For: Strains:   AVN/Orl   BBDP/Rhw   BBDR/Rhw   BC/CpbU   BDIX/Han   BDVII/Cub   BN/SsNHsd   BP/Cub   BUF/Pit   DA/PitN   DON/Melb   F344/Pit   FHH/Eur   IS/Kyo   LE/Mol   LEW/Pit   LH/Mav   MHS/Gib   MNRA/N   WN/N   WKY/OlaHsd   WTC/Kyo   LOU/CHan   MNR/N   MR/Pit   ODU/N   WF/Pit   WIST/Nhg   SR/Jr   MNS/Gib   NP9   OKA/Wsl   OM/Ztm   P5C   PVG/Pit   SD/Rij   SHR/OlaHsd   SHRSP/Riv   WAG/RijKyo   GK/KyoSwe   M520/N   ACI/N   BN-Lx/Cub   LN/Mav   GH/Omr   NEDH/K   SS/Jr   COP/OlaHsd  
QTLs:   Bss92  
Genes:   Igfbp3  


Annotation



Strains and Sequence

Sequence
 
Forward Primer GCACAAAAGACTGCCAACAA
Reverse Primer GCTTTTGGTTGACTACTGCG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
2874Igfbp3insulin-like growth factor binding protein 3148745764787465374Rat

Nucleotide Sequences
RefSeq Transcripts NM_012588 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
GenBank Nucleotide M31837 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles
  M33300 (Get FASTA)   NCBI Sequence Viewer   Search GEO for Microarray Profiles


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
CRRD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
631839Niddm37Non-insulin dependent diabetes mellitus QTL 373.37blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1412680424106641756Rat
631523Pia13Pristane induced arthritis QTL 133.3joint integrity trait (VT:0010548)joint inflammation composite score (CMO:0000919)1442442731108833671Rat
1300136Rf22Renal function QTL 223.9renal blood flow trait (VT:2000006)absolute change in renal vascular resistance (CMO:0001900)1443910761105074364Rat
1549834Scl45Serum cholesterol level QTL 455.8blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1451818462105074364Rat
9590294Uminl4Urine mineral level QTL 45.660.001urine mineral amount (VT:0015086)urine electrolyte level (CMO:0000593)1460980905105980905Rat
9589034Epfw11Epididymal fat weight QTL 1160.001epididymal fat pad mass (VT:0010421)epididymal fat pad weight to body weight ratio (CMO:0000658)1460980905105980905Rat
738037Hcas6Hepatocarcinoma susceptibility QTL 62.93liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)146187332388870994Rat
2317879Alcrsp27Alcohol response QTL 273.30.63response to alcohol trait (VT:0010489)duration of loss of righting reflex (CMO:0002289)1461993178106993178Rat
634328Hc5Hypercalciuria QTL 52.3urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)1463548095108548095Rat
70153Bp59Blood pressure QTL 593.2arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)147339146788870994Rat
1582236Gluco22Glucose level QTL 223.30.0164blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1478172765102549388Rat
1582255Gluco29Glucose level QTL 293.10.0025blood glucose amount (VT:0000188)absolute change in blood glucose level area under curve (CMO:0002034)1478172765102549388Rat
1582197Gluco27Glucose level QTL 273.40.0006blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1478172765102549388Rat
1582209Gluco20Glucose level QTL 203.80.0005blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1478172765102549388Rat
1582250Gluco26Glucose level QTL 263.30.0009blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)1478172765106641756Rat
2300197Scl59Serum cholesterol level QTL 59blood cholesterol amount (VT:0000180)serum total cholesterol level (CMO:0000363)1478446303110402569Rat
1582259Gluco23Glucose level QTL 233.10.0008blood glucose amount (VT:0000188)blood glucose level area under curve (AUC) (CMO:0000350)1480049285115493446Rat
1641900Alcrsp11Alcohol response QTL 11alcohol metabolism trait (VT:0015089)blood ethanol level (CMO:0000535)1480049285115493446Rat
631213Bw60Body weight QTL604.51retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)1485307663106641756Rat
4889951Bss92Bone structure and strength QTL 923.9tibia area (VT:1000281)tibia-fibula cortical bone total cross-sectional area (CMO:0001721)1487458772106641756Rat


Additional Information

RGD Curation Notes
Note Type Note Reference
Database Acc Id Source(s)
NCBI Gene 100528051 UniSTS
  24484 UniSTS
NCBI Nucleotide M33300
UniGene Rn.26369 UniSTS
UniSTS 120186 UniSTS