AI451249 Marker Search Result - Rat Genome Database

Gene Annotator (Functional Annotation) unavailable	Gene Annotator (Annotation Distribution) unavailable	Variant Visualizer (Genomic Variants) unavailble Variant Visualizer (Genomic Variants) unavailable
Gene Annotator (Functional Annotation)	Gene Annotator (Annotation Distribution)	Variant Visualizer (Genomic Variants)

InterViewer (Protein-Protein Interactions) unavailable	Gviewer (Genome Viewer) unavailable	Variant Visualizer (Damaging Variants) unavailble Variant Visualizer (Damaging Variants) unavailable
InterViewer (Protein-Protein Interactions)	GViewer (Genome Viewer)	Variant Visualizer (Damaging Variants)

Gene Annotator (Annotation Comparison) unavailable	OLGA (Gene List Generator) unavailable
Gene Annotator (Annotation Comparison)	OLGA (Gene List Generator)	Excel (Download)

MOET (Multi-Ontology Enrichement) unavailable	GOLF (Gene-Ortholog Location Finder) unavailable
MOET (Multi-Ontology Enrichement)	GOLF (Gene-Ortholog Location Finder)

Search RGD Grant Resources Citing RGD About Us Contact Us

Genes QTLs Strains Markers Genome Information Ontologies Cell Lines References FTP Download Submit Data

OntoMate (Literature Search) JBrowse (Genome Browser) Variant Visualizer Multi-Ontology Enrichment (MOET) Gene-Ortholog Location Finder (GOLF) InterViewer (Protein-Protein Interactions) PhenoMiner (Quatitative Phenotypes) Gene Annotator OLGA (Gene List Generator) RatMine GViewer (Genome Viewer) Overgo Probe Designer ACP Haplotyper Genome Scanner

Aging & Age-Related Disease Cancer Cardiovascular Disease Developmental Disease Diabetes Hematologic Disease Immune & Inflammatory Disease Neurological Disease Obesity & Metabolic Syndrome Renal Disease Respiratory Disease Sensory Organ Disease

Genetic Models PhenoMiner (Quantitative Phenotypes) Expected Ranges (Quantitative Phenotype) PhenoMiner Term Comparison Hybrid Rat Diversity Panel Phenotypes GERRC (Gene Editing Rat Resource Center) Phenotypes in Other Animal Models Animal Husbandry Strain Medical Records Phylogenetics Strain Availability Calendar Rats 101 Submissions Photo Archive

Pathways

Rat Community Forum Directory of Rat Laboratories Video Tutorials News RGD Publications RGD Poster Archive Nomenclature Guidelines Resource Links Laboratory Resources Employment Resources

Advanced Search (OLGA)
OntoMate (Literature Search)

General

Marker: AI451249

Symbol:

AI451249

Also known as:

434046;

Expected Size:

80 (bp)

Position

Mouse Assembly	Chr	Position (strand)	Source	JBrowse
GRCm38	19	4,887,132 - 4,887,211	UniSTS	GRCm38
MGSCv37	19	4,887,132 - 4,887,211	UniSTS	GRCm37
Celera	19	4,758,046 - 4,758,125	UniSTS
Cytogenetic Map	19	A	UniSTS
Whitehead/MRC_RH	19	65.1	UniSTS

Is Marker For:

Genes: Bbs1

Annotation

References - curated

1.	RGD automated pipelines

Strains and Sequence

Sequence


Forward Primer	GAGAGAATAACAGCCAGCCC
Reverse Primer	GTCTTCTGTGCTCTGTCCCA

Region

Genes in Region (GRCm38)

The following Genes overlap with this region.

RGD ID	Symbol	Name	Chr	Start	Stop	Species
1316859	Bbs1	Bardet-Biedl syndrome 1 (human)	19	4886878	4906653	Mouse

Nucleotide Sequences

RefSeq Transcripts	NM_001033128	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
GenBank Nucleotide	AC141437	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	AI451249	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	BC076577	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles
	GL590974	(Get FASTA)	NCBI Sequence Viewer	Search GEO for Microarray Profiles

QTLs in Region (GRCm38)

The following QTLs overlap with this region.

CRRD ID	Symbol	Name	LOD	P Value	Trait	Sub Trait	Chr	Start	Stop	Species
1300776	Lfp3_m	long free running period 3 (mouse)			Not determined		19	1	20278703	Mouse
4142161	Drinksac2_m	drink saccharin 2 (mouse)			Not determined			1	20645286	Mouse
4142302	Nstr1_m	nerve sheath tumor resistance QTL 1 (mouse)			Not determined		19	1	22321310	Mouse
1301271	Datd_m	dopamine transporter density (mouse)			Not determined		19	1	32362870	Mouse
4142406	Pbctlp1_m	peripheral blood cytotoxic T lymphocyte percentage 1 (mouse)			Not determined			1	32897810	Mouse
1300904	Chab5_m	cholesterol absorption 5 (mouse)			Not determined		19	1676400	35676563	Mouse
1357819	Tgct2_m	testicular germ cell tumor 2 (mouse)			Not determined		19	3278551	20562299	Mouse
1300923	Bits4_m	bitterness sensitivity 4 (mouse)			Not determined		19	3345852	37345984	Mouse
1301800	Faq10_m	fluctuating asymmetry QTL 10 (mouse)			Not determined		19	3345852	37345984	Mouse
1300591	Pas3_m	pulmonary adenoma susceptibility 3 (mouse)			Not determined		19	3345852	37345984	Mouse
1302126	Skull26_m	skull morphology 26 (mouse)			Not determined		19	3345852	37345984	Mouse

Additional Information

External Database Links

Database	Acc Id	Source(s)
NCBI Gene	52028	UniSTS
UniGene	Mm.23636	UniSTS
UniSTS	181179	UniSTS

More on AI451249
	JBrowse: mm9 mm10
	Ensembl
	NCBI

CRRD Object Information
CRRD ID:	4907397
Created:	2011-03-01
Species:	Mus musculus
Last Modified:	2014-08-05
Status:	ACTIVE

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.