D17Jcs2 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D17Jcs2

Symbol: D17Jcs2
Also known as:
CRRD ID: 4969931
Expected Size: 287 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381720,348,526 - 20,348,804UniSTSGRCm38
MGSCv371720,485,490 - 20,485,768UniSTSGRCm37
Celera1721,390,700 - 21,390,986UniSTS
Cytogenetic Map17A3.2UniSTS
cM Map17 UniSTS
Is Marker For: Genes:   Vmn2r107  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GACAGGTGCAGAATGATTTTATG
Reverse Primer ACATTAATTGCCCAGGAGGA
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
1622360Vmn2r107vomeronasal 2, receptor 107172034542520375772Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
CRRD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357452Vtbt18_mvertebral trabecular bone trait 18 (mouse)Not determined17120924747Mouse
1302196Myaa1_mmodifier of Yaa 1 (mouse)Not determined17120924747Mouse
1357902Obq19_mobesity QTL 19 (mouse)Not determined17125443244Mouse
12910982Pifs2_mpeptide-induced fatal syndrome 2 (mouse)17125970523Mouse
1357743Lith3_mlithogenic gene 3 (mouse)Not determined17125975624Mouse
1300613Pcyts4_mplasmacytoma susceptibility 4 (mouse)Not determined17126862710Mouse
1301615Cfld3_mcystic fibrosis lung disease 3 (mouse)Not determined17126862710Mouse
1302100Circp2_mcircadian photosensitivity 2 (mouse)Not determined17128979566Mouse
12910527Nrq1a_mnoise-induced hearing loss resistant QTL 1a (mouse)17128979566Mouse
12910528Nrq1_mnoise-induced hearing loss resistant QTL 1 (mouse)17128979566Mouse
13524851Asrq8_macoustic startle response 8 (mouse)17130809908Mouse
10412276Leci2_mleukocyte endothelial cell interactions 2 (mouse)Not determined17312791337128037Mouse
1357680Idd23_minsulin dependent diabetes susceptibility 23 (mouse)Not determined17392461526182159Mouse
1300890Bhr3_mbronchial hyperresponsiveness 3 (mouse)Not determined17392461548559063Mouse
1301327Lmr7_mleishmaniasis resistance 7 (mouse)Not determined17480447727496965Mouse
4141215Mnic1_mmacronutrient intake, carbohydrate 1 (mouse)Not determined480447745359340Mouse
1300706Alan1_malloantigen response 1 (mouse)Not determined17480447746158776Mouse
1357789Kdnw3_mkidney weight 3 (mouse)Not determined17480447747574740Mouse
4141272Tfv1_mtotal food volume 1 (mouse)Not determined480447765330362Mouse
10043949Pbft7_mpercent body fat 7 (mouse)Not determined17667496240674962Mouse
4141608Phl1_mprogressive hearing loss 1 (mouse)Not determined17765701129268449Mouse
1301935Skull24_mskull morphology 24 (mouse)Not determined17836594042366175Mouse
1300787Cd8mts5_mCD8 memory T cell subset 5 (mouse)Not determined17836594042366175Mouse
1301338Lmr1_mleishmaniasis resistance 1 (mouse)Not determined17986241186688972Mouse
1302028Asbb3_mautoimmune susceptibility in C57BL/6J and BALB/c 3 (mouse)Not determined171065914544659245Mouse
4142342Lfnq4_mlung function QTL 4 (mouse)Not determined1098759739053168Mouse
4141067Hbnr2_mHeligmosomoides bakeri nematode resistance 2 (mouse)Not determined1166699745667145Mouse
14747010Mancz14_mmandible centroid size 14 (mouse)171177921045779210Mouse
4142507Obrq13_mobesity resistance QTL 13 (mouse)Not determined1197944224857795Mouse
4142150Stheal11_msoft tissue heal 11 (mouse)Not determined171206732483054339Mouse
12904946Tammq8_mtibialis anterior muscle mass QTL 8 (mouse)171223281346232813Mouse
1558807Ceat1_mchronic experimental autoimmune thyroiditis 1 (mouse)Not determined171241779526182159Mouse
13524847Asrq8a_macoustic startle response 8a (mouse)171242798746427987Mouse
11081168Tir7_mtrypanosome infection response 7 (mouse)171390439847904522Mouse
1300914Pcir4_mperiosteal circumference 4 (mouse)Not determined171484267848842786Mouse
1558886Lgth9_mbody length 9 (mouse)Not determined171484267848842786Mouse
1302070Tbbmd7_mtotal body bone mineral density 7 (mouse)Not determined171484267848842786Mouse
1300995Fembrs4_mfemur breaking strength 4 (mouse)Not determined171484267848842786Mouse
1302140Wta4_mweight adult 4 (mouse)Not determined171660074750600869Mouse
1302152Skull25_mskull morphology 25 (mouse)Not determined171660074750600869Mouse
1301505Tir1_mtrypanosome infection response 1 (mouse)Not determined171660074750600869Mouse
1302038Radpf1_mradiation pulmonary fibrosis 1 (mouse)Not determined171661519333600869Mouse
10412083Sm2_msusceptibility to Schistosoma mansoni infection 2 (mouse)Not determined171681096950811104Mouse
1302042Acsns3_mAngiostrongylus costaricensis nematode susceptibility 3 (mouse)Not determined171724323451243371Mouse
1300535Char3_mP. chabaudi malaria resistance QTL 3 (mouse)Not determined171724323451243371Mouse
10412214Sxbq3_mSGC/Knj cross B6 QTL 3 (mouse)Not determined171724323451243371Mouse
13452396Leusq3_mleucocytosis susceptibility QTL 3 (mouse)171724323451243371Mouse
13452399Leusq6_mleucocytosis susceptibility QTL 6 (mouse)171724323451243371Mouse
1301840Ssial4_msusceptibility to sialadenitiss 4 (mouse)Not determined171795643651959238Mouse
1301331Lbw1_mlupus NZB x NZW 1 (mouse)Not determined171819938152202007Mouse
1301056Pas2_mpulmonary adenoma susceptibility 2 (mouse)Not determined171820316552205351Mouse
15039354Nmrs36_mNAFLD-associated magnetic resonance shift 36 (mouse)171883413352834133Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:2668622 UniSTS
NCBI Gene 22312 UniSTS
  360042 UniSTS
UniSTS 259268 UniSTS