PMC262691P3 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: PMC262691P3

Symbol: PMC262691P3
Also known as:
CRRD ID: 4980132
Expected Size: 172 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381746,017,793 - 46,017,964UniSTSGRCm38
MGSCv371746,154,742 - 46,154,913UniSTSGRCm37
Celera1749,448,865 - 49,449,036UniSTS
Cytogenetic Map17CUniSTS
cM Map1724.2UniSTS
Is Marker For: Genes:   Vegfa  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GAAGAAGAGGCCTGGTAATG
Reverse Primer GGAAGATGAGGAAGGGTAAG
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
731073Vegfavascular endothelial growth factor A174601699346032377Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
CRRD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1300890Bhr3_mbronchial hyperresponsiveness 3 (mouse)Not determined17392461548559063Mouse
1300706Alan1_malloantigen response 1 (mouse)Not determined17480447746158776Mouse
1357789Kdnw3_mkidney weight 3 (mouse)Not determined17480447747574740Mouse
4141272Tfv1_mtotal food volume 1 (mouse)Not determined480447765330362Mouse
1301338Lmr1_mleishmaniasis resistance 1 (mouse)Not determined17986241186688972Mouse
4142150Stheal11_msoft tissue heal 11 (mouse)Not determined171206732483054339Mouse
12904946Tammq8_mtibialis anterior muscle mass QTL 8 (mouse)171223281346232813Mouse
13524847Asrq8a_macoustic startle response 8a (mouse)171242798746427987Mouse
11081168Tir7_mtrypanosome infection response 7 (mouse)171390439847904522Mouse
1300914Pcir4_mperiosteal circumference 4 (mouse)Not determined171484267848842786Mouse
1558886Lgth9_mbody length 9 (mouse)Not determined171484267848842786Mouse
1302070Tbbmd7_mtotal body bone mineral density 7 (mouse)Not determined171484267848842786Mouse
1300995Fembrs4_mfemur breaking strength 4 (mouse)Not determined171484267848842786Mouse
1302140Wta4_mweight adult 4 (mouse)Not determined171660074750600869Mouse
1302152Skull25_mskull morphology 25 (mouse)Not determined171660074750600869Mouse
1301505Tir1_mtrypanosome infection response 1 (mouse)Not determined171660074750600869Mouse
10412083Sm2_msusceptibility to Schistosoma mansoni infection 2 (mouse)Not determined171681096950811104Mouse
1302042Acsns3_mAngiostrongylus costaricensis nematode susceptibility 3 (mouse)Not determined171724323451243371Mouse
1300535Char3_mP. chabaudi malaria resistance QTL 3 (mouse)Not determined171724323451243371Mouse
10412214Sxbq3_mSGC/Knj cross B6 QTL 3 (mouse)Not determined171724323451243371Mouse
13452396Leusq3_mleucocytosis susceptibility QTL 3 (mouse)171724323451243371Mouse
13452399Leusq6_mleucocytosis susceptibility QTL 6 (mouse)171724323451243371Mouse
1301840Ssial4_msusceptibility to sialadenitiss 4 (mouse)Not determined171795643651959238Mouse
1301331Lbw1_mlupus NZB x NZW 1 (mouse)Not determined171819938152202007Mouse
1301056Pas2_mpulmonary adenoma susceptibility 2 (mouse)Not determined171820316552205351Mouse
15039354Nmrs36_mNAFLD-associated magnetic resonance shift 36 (mouse)171883413352834133Mouse
1301454Eae5_msusceptibility to experimental allergic encephalomyelitis 5 (mouse)Not determined172430185958301973Mouse
10412198Sst5_msusceptibility to tuberculosis 5 (mouse)Not determined172485760955405969Mouse
10412204Bbaa29_mB.burgdorferi-associated arthritis 29 (mouse)Not determined172574029459740461Mouse
1558758Kcal2_mkilocalorie 2 (mouse)Not determined172618203852604676Mouse
1302005Loco2_mlocomotor activity 2 (mouse)Not determined172657408160574223Mouse
15039348Nmrs37_mNAFLD-associated magnetic resonance shift 37 (mouse)172750432261504322Mouse
1300703Uvbi2_mUVB induced immunosuppression 2 (mouse)Not determined172831148062311728Mouse
1300589Myaa2_mmodifier of Yaa 2 (mouse)Not determined172982162963821740Mouse
4140955Plgr1_mplague resistance locus 1 (mouse)Not determined3072257564722705Mouse
4141357Mrdq1_mmodifier of retinal degeneration QTL 1 (mouse)Not determined3076892947728778Mouse
26884379Skwq5_mskull length QTL 5, 5 week (mouse)173290000053800000Mouse
1300885Mbis4_mMycobacterium bovis-induced systemic lupus erythematosus 4 (mouse)Not determined173495684169858931Mouse
10755514Amzn2_manatomical modifier of Zfp423 2 (mouse)173565926669659396Mouse
12904951Smmq2_msoleus muscle mass QTL 2 (mouse)173648271570482715Mouse
1300592Pcyts5_mplasmacytoma susceptibility 5 (mouse)Not determined173840588672405969Mouse
10755525Lymph2_mlymphocyte differential 2 (mouse)173849862572498625Mouse
10755534Lymph4_mlymphocyte differential 4 (mouse)173849862572498625Mouse
4141319Hmtb8_mhemostasis and thrombosis rebleeding time 8 (mouse)Not determined4022744774227623Mouse
15039324Nmrs48_mNAFLD-associated magnetic resonance shift 48 (mouse)174063218774632187Mouse
4141478Hbnr7_mHeligmosomoides bakeri nematode resistance 7 (mouse)Not determined4274029451432094Mouse
25394539Skmw85_mskeletal muscle weight 85, gastroc (mouse)174339677746521031Mouse
26884386Skwq13_mskull length QTL 13, 16 week (mouse)174340000052800000Mouse
26884390Skwq9_mskull length QTL 9, 10 week (mouse)174340000067500000Mouse
12903997Cfq4_mconditioned fear QTL 4 (mouse)174470566549059374Mouse


Additional Information

Database Acc Id Source(s)
NCBI Gene 22339 UniSTS
UniGene Mm.282184 UniSTS
UniSTS 272325 UniSTS