56S Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: 56S

Symbol: 56S
Also known as:
CRRD ID: 5006252
Expected Size: 188 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381736,926,923 - 36,927,110UniSTSGRCm38
MGSCv371737,063,868 - 37,064,055UniSTSGRCm37
Celera1740,355,798 - 40,355,985UniSTS
Celera1740,346,014 - 40,346,201UniSTS
cM Map17 UniSTS
Is Marker For: Genes:   1700031A10Rik  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer GCTTGTCTAAGACTGGCATTAC
Reverse Primer GTGGCTCAGTAGATAAAGATGC
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
16118411700031A10RikRIKEN cDNA 1700031A10 gene173692379236933432Mouse



QTLs in Region (GRCm38)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
CRRD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
10412276Leci2_mleukocyte endothelial cell interactions 2 (mouse)Not determined17312791337128037Mouse
1300890Bhr3_mbronchial hyperresponsiveness 3 (mouse)Not determined17392461548559063Mouse
4141215Mnic1_mmacronutrient intake, carbohydrate 1 (mouse)Not determined480447745359340Mouse
1300706Alan1_malloantigen response 1 (mouse)Not determined17480447746158776Mouse
1357789Kdnw3_mkidney weight 3 (mouse)Not determined17480447747574740Mouse
4141272Tfv1_mtotal food volume 1 (mouse)Not determined480447765330362Mouse
10043949Pbft7_mpercent body fat 7 (mouse)Not determined17667496240674962Mouse
1301935Skull24_mskull morphology 24 (mouse)Not determined17836594042366175Mouse
1300787Cd8mts5_mCD8 memory T cell subset 5 (mouse)Not determined17836594042366175Mouse
1301338Lmr1_mleishmaniasis resistance 1 (mouse)Not determined17986241186688972Mouse
1302028Asbb3_mautoimmune susceptibility in C57BL/6J and BALB/c 3 (mouse)Not determined171065914544659245Mouse
4142342Lfnq4_mlung function QTL 4 (mouse)Not determined1098759739053168Mouse
4141067Hbnr2_mHeligmosomoides bakeri nematode resistance 2 (mouse)Not determined1166699745667145Mouse
14747010Mancz14_mmandible centroid size 14 (mouse)171177921045779210Mouse
4142150Stheal11_msoft tissue heal 11 (mouse)Not determined171206732483054339Mouse
12904946Tammq8_mtibialis anterior muscle mass QTL 8 (mouse)171223281346232813Mouse
13524847Asrq8a_macoustic startle response 8a (mouse)171242798746427987Mouse
11081168Tir7_mtrypanosome infection response 7 (mouse)171390439847904522Mouse
1300914Pcir4_mperiosteal circumference 4 (mouse)Not determined171484267848842786Mouse
1558886Lgth9_mbody length 9 (mouse)Not determined171484267848842786Mouse
1302070Tbbmd7_mtotal body bone mineral density 7 (mouse)Not determined171484267848842786Mouse
1300995Fembrs4_mfemur breaking strength 4 (mouse)Not determined171484267848842786Mouse
1302140Wta4_mweight adult 4 (mouse)Not determined171660074750600869Mouse
1302152Skull25_mskull morphology 25 (mouse)Not determined171660074750600869Mouse
1301505Tir1_mtrypanosome infection response 1 (mouse)Not determined171660074750600869Mouse
10412083Sm2_msusceptibility to Schistosoma mansoni infection 2 (mouse)Not determined171681096950811104Mouse
1302042Acsns3_mAngiostrongylus costaricensis nematode susceptibility 3 (mouse)Not determined171724323451243371Mouse
1300535Char3_mP. chabaudi malaria resistance QTL 3 (mouse)Not determined171724323451243371Mouse
10412214Sxbq3_mSGC/Knj cross B6 QTL 3 (mouse)Not determined171724323451243371Mouse
13452396Leusq3_mleucocytosis susceptibility QTL 3 (mouse)171724323451243371Mouse
13452399Leusq6_mleucocytosis susceptibility QTL 6 (mouse)171724323451243371Mouse
1301840Ssial4_msusceptibility to sialadenitiss 4 (mouse)Not determined171795643651959238Mouse
1301331Lbw1_mlupus NZB x NZW 1 (mouse)Not determined171819938152202007Mouse
1301056Pas2_mpulmonary adenoma susceptibility 2 (mouse)Not determined171820316552205351Mouse
15039354Nmrs36_mNAFLD-associated magnetic resonance shift 36 (mouse)171883413352834133Mouse
1301454Eae5_msusceptibility to experimental allergic encephalomyelitis 5 (mouse)Not determined172430185958301973Mouse
10412198Sst5_msusceptibility to tuberculosis 5 (mouse)Not determined172485760955405969Mouse
10412196Bbaa28_mB.burgdorferi-associated arthritis 28 (mouse)Not determined172536594043665344Mouse
10412204Bbaa29_mB.burgdorferi-associated arthritis 29 (mouse)Not determined172574029459740461Mouse
1558758Kcal2_mkilocalorie 2 (mouse)Not determined172618203852604676Mouse
1300602Eye2_meye weight 2 (mouse)Not determined172628636340794146Mouse
1302005Loco2_mlocomotor activity 2 (mouse)Not determined172657408160574223Mouse
11075105Modc1_mmodifier of Odc1 (mouse)172749681845311728Mouse
15039348Nmrs37_mNAFLD-associated magnetic resonance shift 37 (mouse)172750432261504322Mouse
10045977Tir9_mtrypanosome infection response 9 (mouse)Not determined172765914543574223Mouse
1300703Uvbi2_mUVB induced immunosuppression 2 (mouse)Not determined172831148062311728Mouse
1300589Myaa2_mmodifier of Yaa 2 (mouse)Not determined172982162963821740Mouse
4140955Plgr1_mplague resistance locus 1 (mouse)Not determined3072257564722705Mouse
4141357Mrdq1_mmodifier of retinal degeneration QTL 1 (mouse)Not determined3076892947728778Mouse
1300692Blmpf1_mbleomycin-induced pulmonary fibrosis 1 (mouse)Not determined173184267837333884Mouse
26884379Skwq5_mskull length QTL 5, 5 week (mouse)173290000053800000Mouse
1300885Mbis4_mMycobacterium bovis-induced systemic lupus erythematosus 4 (mouse)Not determined173495684169858931Mouse
10755514Amzn2_manatomical modifier of Zfp423 2 (mouse)173565926669659396Mouse
12904951Smmq2_msoleus muscle mass QTL 2 (mouse)173648271570482715Mouse


Additional Information

Database Acc Id Source(s)
MGD MGI:1339311 UniSTS
NCBI Gene 27459 UniSTS
  73286 UniSTS
UniSTS 140972 UniSTS