UniSTS:224589 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: UniSTS:224589

Symbol: UniSTS:224589
Also known as:
CRRD ID: 5507115
Expected Size: 126 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0418,395,341 - 18,395,466NCBIRnor6.0
Rnor_5.0418,354,718 - 18,354,843UniSTSRnor5.0
RGSC_v3.4417,790,276 - 17,790,401UniSTSRGSC3.4
Celera417,013,824 - 17,013,949UniSTS
Cytogenetic Map4q12UniSTS
Is Marker For: Genes:   Sema3a  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer CACGGAATCACAGAAACTTCAA
Reverse Primer CGCAGCCCTTGTTAATTTTT
 

Region

Genes in Region
The following Genes overlap with this region.    Full Report CSV TAB Printer Analysis Tools
RGD IDSymbolNameChrStartStopSpecies
3657Sema3asemaphorin 3A41817037518545190Rat

Nucleotide Sequences


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
CRRD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
61408Scl23Serum cholesterol level QTL 230.0005blood HDL phospholipid amount (VT:0010504)serum high density lipoprotein phospholipid level (CMO:0001567)4125545519Rat
724557Plsm1Polydactyly-luxate syndrome (PLS) morphotypes QTL 10.0003forelimb integrity trait (VT:0010562)front foot phalanges count (CMO:0001947)4125545519Rat
61351Bp33Blood pressure QTL 330.0018arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4125545519Rat
1641905Colcr1Colorectal carcinoma resistance QTL 14.30.0003intestine integrity trait (VT:0010554)benign colorectal tumor surface area measurement (CMO:0001799)4126654881Rat
61333Gluco16Glucose level QTL 164.30.00001adipocyte glucose uptake trait (VT:0004185)absolute change in adipocyte glucose uptake (CMO:0000873)4126803291Rat
9589046Scfw2Subcutaneous fat weight QTL 25.540.001subcutaneous adipose mass (VT:1000472)abdominal subcutaneous fat pad weight (CMO:0002069)4128352196Rat
9589097Slep11Serum leptin concentration QTL 115.090.001blood leptin amount (VT:0005667)plasma leptin level (CMO:0000781)4128352196Rat
9590100Sffal4Serum free fatty acids level QTL 47.360.05blood free fatty acid amount (VT:0001553)plasma free fatty acids level (CMO:0000546)4128352196Rat
8552903Pigfal2Plasma insulin-like growth factor 1 level QTL 27.3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)4128352196Rat
1357343Gluco4Glucose level QTL 40.00002adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874)4129778604Rat
1357341Gluco5Glucose level QTL 56.4adipocyte free fatty acid secretion trait (VT:0010465)absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446)4129778604Rat
738021Hcar13Hepatocarcinoma resistance QTL 134.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)4131554484Rat
634323Hc2Hypercalciuria QTL 22.15urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)4142118977Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4304323179575658Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)43043231145254791Rat
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4304401755791834Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4304401764915903Rat
1358201Gluco12Glucose level QTL121.6adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake (CMO:0000870)4304411426753655Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4304780755324857Rat
631209Bw2Body weight QTL24.2retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)4646769343414792Rat
1300141Bp178Blood pressure QTL 178arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4657293937703537Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)4734240492484039Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)47850904182171018Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4805218953052189Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)4805218953052189Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)4805218953052189Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4805218953052189Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)4805218953052189Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)4805218953052189Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41263897457638974Rat
7387227Uae40Urinary albumin excretion QTL 402.90.0052urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)41614994161149941Rat
70222Eae2Experimental allergic encephalomyelitis QTL 24.3nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)41822218737685319Rat
1354665Stl10Serum triglyceride level QTL 103.57blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)41822218743414792Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)41822218761039065Rat


Additional Information

Database Acc Id Source(s)
NCBI Gene 29751 UniSTS
UniSTS 224589 UniSTS