Pkd1 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: Pkd1

Symbol: Pkd1
Also known as:
CRRD ID: 7193400
Expected Size: 111 (bp)
Position
Mouse AssemblyChrPosition (strand)SourceJBrowse
GRCm381724,595,694 - 24,595,804UniSTSGRCm38
MGSCv371724,732,639 - 24,732,749UniSTSGRCm37
Celera1725,113,689 - 25,113,799UniSTS
Cytogenetic Map17A3.3UniSTS
Is Marker For: Genes:   Pkd1   Tsc2  


Annotation


References - curated
1. RGD automated pipelines

Strains and Sequence

Sequence
 
Forward Primer ATTGCTGCCTTCCTTACCTGTCCA
Reverse Primer TCCAATACTGCTGTGTCCTCCTGT
 

Region



Additional Information

Database Acc Id Source(s)
MGD MGI:4821998 UniSTS
NCBI Gene 18763 UniSTS
  22084 UniSTS
UniGene Mm.290442 UniSTS
  Mm.439445 UniSTS
UniSTS 531218 UniSTS