D4Kini4 Marker Search Result - Rat Genome Database
Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Marker: D4Kini4

Symbol: D4Kini4
Also known as:
CRRD ID: 7241151
Expected Size: 285 (bp)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.0428,439,589 - 28,439,873NCBIRnor6.0
Cytogenetic Map4 RGD


Annotation



Strains and Sequence

Sequence
 
Forward Primer GCACAGTTGATAATCTACCA
Reverse Primer ATGAACAGGAAGTCATGTGT
 

Region

Nucleotide Sequences


QTLs in Region (Rnor_6.0)
The following QTLs overlap with this region.    Full Report CSV TAB Printer Gviewer
CRRD IDSymbolNameLODP ValueTraitSub TraitChrStartStopSpecies
1357343Gluco4Glucose level QTL 40.00002adipocyte glucose uptake trait (VT:0004185)adipocyte maximal glucose uptake to basal glucose uptake ratio (CMO:0000874)4129778604Rat
1357341Gluco5Glucose level QTL 56.4adipocyte free fatty acid secretion trait (VT:0010465)absolute change in adipocyte free fatty acid secretion per unit volume (CMO:0001446)4129778604Rat
738021Hcar13Hepatocarcinoma resistance QTL 134.3liver integrity trait (VT:0010547)liver nonremodeling tumorous lesion volume to total liver volume ratio (CMO:0001464)4131554484Rat
634323Hc2Hypercalciuria QTL 22.15urine calcium amount (VT:0002985)urine calcium excretion rate (CMO:0000763)4142118977Rat
619616Bp79Blood pressure QTL 790.0292arterial blood pressure trait (VT:2000000)systolic blood pressure (CMO:0000004)4304323179575658Rat
2303168Bp330Blood pressure QTL 3304.250.017arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)43043231145254791Rat
2302371Stl22Serum triglyceride level QTL 225.15blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4304401755791834Rat
1358203Stl19Serum triglyceride level QTL 192.80.002blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4304401764915903Rat
631642Stl2Serum triglyceride level QTL 23.3blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)4304780755324857Rat
631209Bw2Body weight QTL24.2retroperitoneal fat pad mass (VT:0010430)retroperitoneal fat pad weight to body weight ratio (CMO:0000635)4646769343414792Rat
1300141Bp178Blood pressure QTL 178arterial blood pressure trait (VT:2000000)mean arterial blood pressure (CMO:0000009)4657293937703537Rat
631261Tcas3Tongue tumor susceptibility QTL 36.88tongue integrity trait (VT:0010553)number of squamous cell tumors of the tongue with diameter greater than 3 mm (CMO:0001950)4734240492484039Rat
2316958Gluco58Glucose level QTL 5810blood glucose amount (VT:0000188)blood glucose level (CMO:0000046)47850904182171018Rat
9590304Scort17Serum corticosterone level QTL 174.960.001blood corticosterone amount (VT:0005345)plasma corticosterone level (CMO:0001173)4805218953052189Rat
6478724Anxrr35Anxiety related response QTL 350.00449defecation behavior trait (VT:0010462)defecation measurement (CMO:0000997)4805218953052189Rat
6478766Anxrr47Anxiety related response QTL 470.09637locomotor behavior trait (VT:0001392)number of entries into a discrete space in an experimental apparatus (CMO:0000960)4805218953052189Rat
6478769Anxrr48Anxiety related response QTL 480.02514locomotor behavior trait (VT:0001392)amount of experiment time spent in a discrete space in an experimental apparatus (CMO:0000958)4805218953052189Rat
8552906Pigfal3Plasma insulin-like growth factor 1 level QTL 3blood insulin-like growth factor amount (VT:0010479)plasma insulin-like growth factor 1 level (CMO:0001299)4805218953052189Rat
8694374Bw155Body weight QTL 1553.390.001body lean mass (VT:0010483)lean tissue morphological measurement (CMO:0002184)4805218953052189Rat
2303585Bw86Body weight QTL 864body mass (VT:0001259)body weight (CMO:0000012)41263897457638974Rat
7387227Uae40Urinary albumin excretion QTL 402.90.0052urine albumin amount (VT:0002871)urine albumin excretion rate (CMO:0000757)41614994161149941Rat
70222Eae2Experimental allergic encephalomyelitis QTL 24.3nervous system integrity trait (VT:0010566)experimental autoimmune encephalomyelitis incidence/prevalence measurement (CMO:0001046)41822218737685319Rat
1354665Stl10Serum triglyceride level QTL 103.57blood triglyceride amount (VT:0002644)serum triglyceride level (CMO:0000360)41822218743414792Rat
61412Pia2Pristane induced arthritis QTL 23.9joint integrity trait (VT:0010548)post-insult time to onset of experimental arthritis (CMO:0001450)41822218761039065Rat
8552803Bw144Body weight QTL 14416body mass (VT:0001259)change in body weight to body weight ratio (CMO:0002216)41961886631825560Rat
10755501Bp390Blood pressure QTL 3902.5arterial blood pressure trait (VT:2000000)diastolic blood pressure (CMO:0000005)423850384169318094Rat
6909122Insul22Insulin level QTL 224.63blood insulin amount (VT:0001560)plasma insulin level (CMO:0000342)42399172176238799Rat
6909128Pancm4Pancreatic morphology QTL 411.35pancreas mass (VT:0010144)pancreas wet weight (CMO:0000626)42399172176238799Rat
1578655Bmd11Bone mineral density QTL 1111femur mineral mass (VT:0010011)total volumetric bone mineral density (CMO:0001728)42463187469631874Rat
8655906Rf60Renal function QTL 603.8blood creatinine amount (VT:0005328)creatinine clearance (CMO:0000765)42665474981874227Rat


Additional Information

Database Acc Id Source(s)
UniSTS 547940 UniSTS