Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Strain: SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi

Symbol: SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi
Strain: SS.BN-(D13Rat25-rs106935835)-Btg2em7
Substrain: Mcwi
Ontology ID: RS:0003973
Alleles: Btg2em7Mcwi
Also known as: SS-Chr 13BN-Btg2em7Mcwi; SS.BN-(D13Rat124-D13Hmgc3694)/Mcwi-Btg2em7Mcwi; SS.BN-(D13Rat25-rs106935835)-Btg2em7Mcwi
Type: mutant
Source: MCW Gene Editing Rat Resource Center
Origin: The Btg2 mutant rats were generated using transcription activator-like effector nuclease (TALEN) constructs specific for the rat Btg2 gene designed to target exon 1 using the target sequence TAGGTTTCCTCACCAGTCtcctgaggactcggggcTGCGTGAGCGAGCAGAGA. The result was a 44-bp deletion mutation in exon 1 (RNO13:50,916,769-50,916,812; aaaccttgagtctctgctcgctcacgcagccccgagtcctcagg) of SS.BN-(D13Rat25-rs106935835)/Mcwi rat embryos.
Last Known Status: Unknown (as of 2020-01-23)
Position
Rat AssemblyChrPosition (strand)SourceJBrowse
Rnor_6.01350,913,185 - 50,916,944RGD_MAPPER_PIPELINERnor6.0
Rnor_5.01355,966,299 - 55,970,058RGD_MAPPER_PIPELINERnor5.0
RGSC_v3.41347,026,986 - 47,030,745RGD_MAPPER_PIPELINERGSC3.4





Experimental Data Annotations
References - curated

Region

Position Markers

Additional Information

Nomenclature History
 
More on this Strain
Strain Nomenclature
Strain Registration

CRRD Object Information
CRRD ID: 10054307
Created: 2015-08-04
Species: Rattus norvegicus
Last Modified: 2016-10-03
Status: ACTIVE



NHLBI Logo

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.