Submit Data |  Help |  Video Tutorials |  News |  Publications |  FTP Download |  REST API |  Citing RGD |  Contact   

Variant : CV411158 (NM_001204527.2(SSR4):c.11-38_11-12dup) Homo sapiens

Symbol: CV411158
Name: NM_001204527.2(SSR4):c.11-38_11-12dup
Condition: not specified [RCV000485292]
Clinical Significance: likely benign
Last Evaluated: 07/20/2016
Review Status: criteria provided, single submitter
Related Genes: SSR4  
Variant Type: duplication (SO:0001627)
Source: CLINVAR
Molecular Consequence: intron variant
Evidence: clinical testing
HGVS Name(s): NM_001204527.2:c.11-38_11-12dup
NC_000023.11:g.153794636_153794662dup
NM_001204526.1:c.20-38_20-12dupCCCTCGTGTTCATGGGAGCTCGTTTTC
NM_001204526.1:c.20-38_20-12dup27
NG_041795.1:g.5462_5488dup
NC_000023.10:g.153060091_153060117dup
NM_001204526.1:c.20-38_20-12dup
Position
Human AssemblyChrPosition (strand)Source
GRCh38X153,794,636 - 153,794,662CLINVAR
GRCh37X153,060,091 - 153,060,117CLINVAR
Cytogenetic MapXXq28CLINVAR
Trait Synonyms: AllHighlyPenetrant




Additional Information

External Database Links
 
CRRD Object Information
CRRD ID: 12901682
Created: 2017-05-09
Species: Homo sapiens
Last Modified: 2019-09-10
Status: ACTIVE



NHLBI Logo

RGD is funded by grant HL64541 from the National Heart, Lung, and Blood Institute on behalf of the NIH.